ID: 1074012139

View in Genome Browser
Species Human (GRCh38)
Location 10:109492988-109493010
Sequence GGTGTAATGAAACTCAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074012139_1074012144 24 Left 1074012139 10:109492988-109493010 CCAGAATTGAGTTTCATTACACC No data
Right 1074012144 10:109493035-109493057 GGAAGAAGTTTGATCACCAAAGG No data
1074012139_1074012140 -10 Left 1074012139 10:109492988-109493010 CCAGAATTGAGTTTCATTACACC No data
Right 1074012140 10:109493001-109493023 TCATTACACCAGTTCTTATGAGG No data
1074012139_1074012142 3 Left 1074012139 10:109492988-109493010 CCAGAATTGAGTTTCATTACACC No data
Right 1074012142 10:109493014-109493036 TCTTATGAGGATACCATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074012139 Original CRISPR GGTGTAATGAAACTCAATTC TGG (reversed) Intergenic
No off target data available for this crispr