ID: 1074012271

View in Genome Browser
Species Human (GRCh38)
Location 10:109494550-109494572
Sequence TAACCACAGCAGCACCAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074012269_1074012271 28 Left 1074012269 10:109494499-109494521 CCATCTCTTTTGTTTGGATTTCA No data
Right 1074012271 10:109494550-109494572 TAACCACAGCAGCACCAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074012271 Original CRISPR TAACCACAGCAGCACCAAAC GGG Intergenic
No off target data available for this crispr