ID: 1074013116

View in Genome Browser
Species Human (GRCh38)
Location 10:109504610-109504632
Sequence CAGGATGAGGAGTTGGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074013116_1074013124 1 Left 1074013116 10:109504610-109504632 CCACAATCCAACTCCTCATCCTG No data
Right 1074013124 10:109504634-109504656 AAGAGGAAATAATATGGGGATGG No data
1074013116_1074013122 -4 Left 1074013116 10:109504610-109504632 CCACAATCCAACTCCTCATCCTG No data
Right 1074013122 10:109504629-109504651 CCTGAAAGAGGAAATAATATGGG No data
1074013116_1074013120 -5 Left 1074013116 10:109504610-109504632 CCACAATCCAACTCCTCATCCTG No data
Right 1074013120 10:109504628-109504650 TCCTGAAAGAGGAAATAATATGG No data
1074013116_1074013123 -3 Left 1074013116 10:109504610-109504632 CCACAATCCAACTCCTCATCCTG No data
Right 1074013123 10:109504630-109504652 CTGAAAGAGGAAATAATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074013116 Original CRISPR CAGGATGAGGAGTTGGATTG TGG (reversed) Intergenic
No off target data available for this crispr