ID: 1074021714

View in Genome Browser
Species Human (GRCh38)
Location 10:109591398-109591420
Sequence CTGTAAAGAGGCAGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074021714_1074021720 22 Left 1074021714 10:109591398-109591420 CCAGCAATTCTGCCTCTTTACAG No data
Right 1074021720 10:109591443-109591465 CATCTGCAAAACATTCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074021714 Original CRISPR CTGTAAAGAGGCAGAATTGC TGG (reversed) Intergenic
No off target data available for this crispr