ID: 1074022718

View in Genome Browser
Species Human (GRCh38)
Location 10:109600824-109600846
Sequence CATCCTTTGAAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074022715_1074022718 -2 Left 1074022715 10:109600803-109600825 CCATAAAAAGGGATAAAATCACA No data
Right 1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG No data
1074022712_1074022718 16 Left 1074022712 10:109600785-109600807 CCACGGAACACAATGCAGCCATA No data
Right 1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074022718 Original CRISPR CATCCTTTGAAGGACATGGA TGG Intergenic
No off target data available for this crispr