ID: 1074024031

View in Genome Browser
Species Human (GRCh38)
Location 10:109615307-109615329
Sequence TCTGCTATTGAGCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074024031_1074024033 29 Left 1074024031 10:109615307-109615329 CCAGCACAGTGCTCAATAGCAGA No data
Right 1074024033 10:109615359-109615381 CCCAACCATGCCATGTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074024031 Original CRISPR TCTGCTATTGAGCACTGTGC TGG (reversed) Intergenic
No off target data available for this crispr