ID: 1074027103

View in Genome Browser
Species Human (GRCh38)
Location 10:109647675-109647697
Sequence CCTGAAGTACATTAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074027103_1074027109 23 Left 1074027103 10:109647675-109647697 CCCTCCAGCTAATGTACTTCAGG No data
Right 1074027109 10:109647721-109647743 TCTCCTCTTAAAAGACAAGGAGG No data
1074027103_1074027107 -4 Left 1074027103 10:109647675-109647697 CCCTCCAGCTAATGTACTTCAGG No data
Right 1074027107 10:109647694-109647716 CAGGACAAAATTCATGATTCAGG No data
1074027103_1074027108 20 Left 1074027103 10:109647675-109647697 CCCTCCAGCTAATGTACTTCAGG No data
Right 1074027108 10:109647718-109647740 TTGTCTCCTCTTAAAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074027103 Original CRISPR CCTGAAGTACATTAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr