ID: 1074027105

View in Genome Browser
Species Human (GRCh38)
Location 10:109647676-109647698
Sequence TCCTGAAGTACATTAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074027105_1074027109 22 Left 1074027105 10:109647676-109647698 CCTCCAGCTAATGTACTTCAGGA No data
Right 1074027109 10:109647721-109647743 TCTCCTCTTAAAAGACAAGGAGG No data
1074027105_1074027108 19 Left 1074027105 10:109647676-109647698 CCTCCAGCTAATGTACTTCAGGA No data
Right 1074027108 10:109647718-109647740 TTGTCTCCTCTTAAAAGACAAGG No data
1074027105_1074027107 -5 Left 1074027105 10:109647676-109647698 CCTCCAGCTAATGTACTTCAGGA No data
Right 1074027107 10:109647694-109647716 CAGGACAAAATTCATGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074027105 Original CRISPR TCCTGAAGTACATTAGCTGG AGG (reversed) Intergenic
No off target data available for this crispr