ID: 1074027107

View in Genome Browser
Species Human (GRCh38)
Location 10:109647694-109647716
Sequence CAGGACAAAATTCATGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074027102_1074027107 12 Left 1074027102 10:109647659-109647681 CCTGAGTTCACAAGTTCCCTCCA No data
Right 1074027107 10:109647694-109647716 CAGGACAAAATTCATGATTCAGG No data
1074027101_1074027107 20 Left 1074027101 10:109647651-109647673 CCACTGTGCCTGAGTTCACAAGT No data
Right 1074027107 10:109647694-109647716 CAGGACAAAATTCATGATTCAGG No data
1074027106_1074027107 -8 Left 1074027106 10:109647679-109647701 CCAGCTAATGTACTTCAGGACAA No data
Right 1074027107 10:109647694-109647716 CAGGACAAAATTCATGATTCAGG No data
1074027105_1074027107 -5 Left 1074027105 10:109647676-109647698 CCTCCAGCTAATGTACTTCAGGA No data
Right 1074027107 10:109647694-109647716 CAGGACAAAATTCATGATTCAGG No data
1074027103_1074027107 -4 Left 1074027103 10:109647675-109647697 CCCTCCAGCTAATGTACTTCAGG No data
Right 1074027107 10:109647694-109647716 CAGGACAAAATTCATGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074027107 Original CRISPR CAGGACAAAATTCATGATTC AGG Intergenic
No off target data available for this crispr