ID: 1074031162

View in Genome Browser
Species Human (GRCh38)
Location 10:109689865-109689887
Sequence AGTTTTCTAGAGAAGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074031162_1074031168 14 Left 1074031162 10:109689865-109689887 CCTGCAATCTTCTCTAGAAAACT No data
Right 1074031168 10:109689902-109689924 TCCTATCACCAAAACCACTTGGG No data
1074031162_1074031167 13 Left 1074031162 10:109689865-109689887 CCTGCAATCTTCTCTAGAAAACT No data
Right 1074031167 10:109689901-109689923 CTCCTATCACCAAAACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074031162 Original CRISPR AGTTTTCTAGAGAAGATTGC AGG (reversed) Intergenic
No off target data available for this crispr