ID: 1074036522

View in Genome Browser
Species Human (GRCh38)
Location 10:109744880-109744902
Sequence CCTCACATGGAGAAGAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074036522_1074036535 16 Left 1074036522 10:109744880-109744902 CCCAAGTTCTTCTCCATGTGAGG No data
Right 1074036535 10:109744919-109744941 CCCTGTCCCAGTCACGGACTGGG No data
1074036522_1074036537 17 Left 1074036522 10:109744880-109744902 CCCAAGTTCTTCTCCATGTGAGG No data
Right 1074036537 10:109744920-109744942 CCTGTCCCAGTCACGGACTGGGG No data
1074036522_1074036531 10 Left 1074036522 10:109744880-109744902 CCCAAGTTCTTCTCCATGTGAGG No data
Right 1074036531 10:109744913-109744935 GTCCAGCCCTGTCCCAGTCACGG No data
1074036522_1074036533 15 Left 1074036522 10:109744880-109744902 CCCAAGTTCTTCTCCATGTGAGG No data
Right 1074036533 10:109744918-109744940 GCCCTGTCCCAGTCACGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074036522 Original CRISPR CCTCACATGGAGAAGAACTT GGG (reversed) Intergenic
No off target data available for this crispr