ID: 1074039217

View in Genome Browser
Species Human (GRCh38)
Location 10:109771612-109771634
Sequence GACTCAGAGCTGCCTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074039217_1074039223 26 Left 1074039217 10:109771612-109771634 CCACACAGAGGCAGCTCTGAGTC No data
Right 1074039223 10:109771661-109771683 TCTGTGAGTTCCTTGCCCTCTGG No data
1074039217_1074039218 -2 Left 1074039217 10:109771612-109771634 CCACACAGAGGCAGCTCTGAGTC No data
Right 1074039218 10:109771633-109771655 TCCACTGTTTCCTGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074039217 Original CRISPR GACTCAGAGCTGCCTCTGTG TGG (reversed) Intergenic
No off target data available for this crispr