ID: 1074048351

View in Genome Browser
Species Human (GRCh38)
Location 10:109860043-109860065
Sequence CAAACTGCTCCCAGTGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074048345_1074048351 10 Left 1074048345 10:109860010-109860032 CCAAAAACCTCTCATACTCACCC No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data
1074048344_1074048351 15 Left 1074048344 10:109860005-109860027 CCTTACCAAAAACCTCTCATACT No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data
1074048342_1074048351 24 Left 1074048342 10:109859996-109860018 CCCTGCAGGCCTTACCAAAAACC No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data
1074048341_1074048351 25 Left 1074048341 10:109859995-109860017 CCCCTGCAGGCCTTACCAAAAAC No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data
1074048343_1074048351 23 Left 1074048343 10:109859997-109860019 CCTGCAGGCCTTACCAAAAACCT No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data
1074048347_1074048351 3 Left 1074048347 10:109860017-109860039 CCTCTCATACTCACCCACTGGAG No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data
1074048349_1074048351 -10 Left 1074048349 10:109860030-109860052 CCCACTGGAGGTGCAAACTGCTC No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data
1074048340_1074048351 29 Left 1074048340 10:109859991-109860013 CCAGCCCCTGCAGGCCTTACCAA No data
Right 1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074048351 Original CRISPR CAAACTGCTCCCAGTGTTAG TGG Intergenic
No off target data available for this crispr