ID: 1074052175

View in Genome Browser
Species Human (GRCh38)
Location 10:109889949-109889971
Sequence GGAGAAACTGTATTAATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074052175_1074052179 15 Left 1074052175 10:109889949-109889971 CCACTTATTAATACAGTTTCTCC 0: 1
1: 0
2: 2
3: 12
4: 268
Right 1074052179 10:109889987-109890009 CTACATAATATAACTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074052175 Original CRISPR GGAGAAACTGTATTAATAAG TGG (reversed) Intronic
900385875 1:2410458-2410480 GGAGAAACAGTATTAGTCCGGGG + Intronic
906979340 1:50612408-50612430 AGAGCTACTGTATTAATCAGTGG + Intronic
907634683 1:56122024-56122046 TGAACAACTGTATTAAGAAGTGG - Intergenic
908816190 1:68037416-68037438 GGAGATAATGTTTTAATAAGAGG + Intergenic
908896023 1:68900325-68900347 GAAGAGACTGTGTTAAAAAGGGG - Intergenic
909328318 1:74380948-74380970 TGAGAAACAATCTTAATAAGTGG + Intronic
909649946 1:77963579-77963601 GGGAAAACTGGATTAATAATAGG - Exonic
910021924 1:82602024-82602046 GGAGAAGAAGTATTAAGAAGTGG - Intergenic
910957065 1:92717620-92717642 GAAGAAACTGTATCAATTAACGG + Intronic
911212992 1:95162567-95162589 GAAGAAACTGTACTGATTAGCGG - Intronic
911217764 1:95214752-95214774 GAAGAAACTGTATTAATTAGCGG - Intronic
911595877 1:99798655-99798677 GAAGAAACTGCATCAATTAGTGG - Intergenic
913939778 1:125090389-125090411 CAAGTAACTGTCTTAATAAGAGG + Intergenic
916931579 1:169583774-169583796 ACAGAAACTGTGTTAATATGTGG + Intronic
917673833 1:177300729-177300751 GGAGAAGCTGAATTAAAATGAGG + Intergenic
918910725 1:190564994-190565016 TGAGAAAATCTATAAATAAGTGG + Intergenic
919264903 1:195250673-195250695 GGAGATAATGCATTAATAATAGG - Intergenic
919469422 1:197959871-197959893 GGAGAAACTCTATTATTATAAGG + Intergenic
921646904 1:217630263-217630285 GGATAAAGTGTATTAATTTGTGG + Intronic
1062991821 10:1826334-1826356 GGAGAAAGTGAATTAAGCAGAGG - Intergenic
1063484086 10:6402954-6402976 GCAGACACTGAATTAAAAAGTGG - Intergenic
1063711882 10:8487199-8487221 GGAGAAAATGTATAATTCAGAGG - Intergenic
1064191432 10:13209251-13209273 GGAGAAACTCTGTTACCAAGAGG + Exonic
1064860620 10:19821145-19821167 GAAGAGACTGTATTAATGTGAGG - Intronic
1066958523 10:42196980-42197002 GGGGAAACTGGATTAGTAACAGG - Intergenic
1068556964 10:58468911-58468933 GGAGAAAGTGTAGAAATAAATGG + Intergenic
1069195631 10:65547570-65547592 TGAGGAACTGTATTCATAAAGGG + Intergenic
1070700972 10:78601574-78601596 GGACAATCTGTATTGAGAAGGGG + Intergenic
1071908037 10:90196797-90196819 GCAGAAGCTGTAGTAAGAAGTGG + Intergenic
1073770379 10:106728953-106728975 GGGGAAACTGTATATAGAAGAGG - Intronic
1074052175 10:109889949-109889971 GGAGAAACTGTATTAATAAGTGG - Intronic
1074547980 10:114416596-114416618 GGAGAAACTGAGGTAAAAAGTGG - Intergenic
1078186600 11:9056873-9056895 TGAGAAACTATGTTAATAAAAGG + Intronic
1078424638 11:11239098-11239120 GGAGAAACTGGGTAAAGAAGAGG + Intergenic
1078981362 11:16538401-16538423 GAAGAAACTGCATTAATTAATGG + Intronic
1080551627 11:33377310-33377332 GGAGAAACTGTGTTGATATTTGG - Intergenic
1081324170 11:41725864-41725886 GAAGAAACTGCATTAATTAACGG - Intergenic
1081337494 11:41884666-41884688 GTAGAAAGTGTATTAGAAAGTGG + Intergenic
1085468580 11:76741326-76741348 GGAGGAGCTGTATGAATTAGGGG - Intergenic
1086442258 11:86840026-86840048 GAAGAAACTGCATTAATTAATGG + Intronic
1086505515 11:87499771-87499793 GAAGAAACTGCATTAATTAATGG + Intergenic
1086831984 11:91577340-91577362 GAAGAAACTGTATCAATTAATGG + Intergenic
1087311333 11:96547092-96547114 GAAGAAACTGCATCAATTAGTGG + Intergenic
1087753933 11:102035494-102035516 GAAGAAACTGTATCAATTAATGG - Intergenic
1087762734 11:102119228-102119250 GGAGAAACTGTATTCACCAGTGG + Intronic
1089004809 11:115082478-115082500 ACAGAGACTGTATTAATAAAAGG + Intergenic
1089738870 11:120568260-120568282 GGAGAAACTGTCTTATTATAAGG - Intronic
1092397206 12:8137773-8137795 GAAAAAACTCTATTGATAAGTGG + Intronic
1092455418 12:8638385-8638407 GGAGAAAGTCCATAAATAAGGGG + Intronic
1092767183 12:11863255-11863277 AGAGAAACTTTTCTAATAAGAGG + Intronic
1094407991 12:30138901-30138923 GGACAACATGTATTAATAAATGG + Intergenic
1095074858 12:37906389-37906411 TGAGAAACTGTTTTGAGAAGTGG - Intergenic
1095531526 12:43192131-43192153 GGGGAAACTGAATGAACAAGAGG - Intergenic
1096221140 12:49828620-49828642 GGAGAAAGTGTTTCTATAAGGGG - Intronic
1099541981 12:83922787-83922809 GGAGAAACAGGAATAGTAAGGGG - Intergenic
1099775502 12:87122735-87122757 GGAGAAAAAGTATAAATTAGTGG + Intergenic
1100248653 12:92791199-92791221 GAAGAAACTGCATTAATTAACGG + Intronic
1100381548 12:94066346-94066368 GAAGAAACTGCATCAATTAGTGG + Intergenic
1101128091 12:101660226-101660248 GGAGAAACTAAAGTAAGAAGAGG - Intronic
1102857192 12:116304524-116304546 GCACAAAGTGTCTTAATAAGTGG - Intergenic
1103208398 12:119148648-119148670 TGAGAAACTCAGTTAATAAGTGG + Intronic
1104442908 12:128809688-128809710 GGAGAAATTACATTAACAAGAGG + Intronic
1105997967 13:25691139-25691161 GGCCAAACTGTAGTAAAAAGAGG + Intronic
1108999902 13:56786303-56786325 GGAGAAAGTGTGTTAATAGGAGG + Intergenic
1109305965 13:60642014-60642036 GCAGGAACAGTAGTAATAAGTGG - Intergenic
1109533071 13:63678714-63678736 GGAAAAAATGTAGTTATAAGTGG + Intergenic
1109596440 13:64561366-64561388 GGAAAAAATCTATTAATAGGTGG - Intergenic
1109833331 13:67823317-67823339 GAAAAAAATATATTAATAAGAGG - Intergenic
1109964078 13:69668808-69668830 GAAGAAACTGGATCAATTAGTGG + Intergenic
1110094446 13:71498794-71498816 GAAGAAACTGTATTTTTAGGGGG + Intronic
1114518326 14:23316187-23316209 CGGGAAAATGTATTAATAAAAGG - Intronic
1114581625 14:23765673-23765695 GGATAACCTGTTTTAAGAAGAGG + Intergenic
1114893904 14:26961508-26961530 GGAGGCAATGTATTAACAAGTGG - Intergenic
1114928361 14:27434236-27434258 GGAAGAAGTGTATTCATAAGTGG + Intergenic
1116188667 14:41634381-41634403 GGAGAAACTGCATTAGACAGAGG - Intronic
1116691572 14:48113794-48113816 GGAAAAACTGGAATAATTAGGGG - Intergenic
1116946341 14:50838730-50838752 GGAGAAAGAGTAGTAATAAAGGG - Intergenic
1118039264 14:61899861-61899883 GGAGGAACTGTGTTCAGAAGGGG + Intergenic
1119106412 14:71929091-71929113 GGAGAAACTGAAATATGAAGTGG - Intergenic
1120287750 14:82526067-82526089 GGAGAAAATGTCTTAATGAATGG - Intergenic
1120375235 14:83696380-83696402 AGAGTAACTGTATTAGAAAGAGG - Intergenic
1120419856 14:84270221-84270243 GTAGAAACTGCATTCATAATAGG + Intergenic
1120499402 14:85275880-85275902 GGAGAATGTGTATGAATACGTGG - Intergenic
1121062531 14:90927546-90927568 GGAGTATCTTTATTAATAGGAGG + Intronic
1121522719 14:94597477-94597499 GGAGTAACAGTAATAATAACAGG + Intronic
1126071453 15:44868205-44868227 GAAGAAACTGTATCAATTAATGG + Intergenic
1126476525 15:49070634-49070656 GAAGAAACTGCATTAATCAATGG + Intergenic
1126995437 15:54438002-54438024 GGAGTAAGTGCATTCATAAGAGG + Intronic
1127243149 15:57141250-57141272 GGAGAAACTGCATCAATATCTGG - Intronic
1127333951 15:57965572-57965594 GGAGAAAATGGTTTAATAATGGG - Intronic
1127408199 15:58675809-58675831 GCAAAAACAGTATTAAGAAGAGG + Intronic
1127797511 15:62451343-62451365 GGAGAATCTGGATTCTTAAGAGG + Intronic
1131989090 15:98075816-98075838 GGTGAAACTGAATTCATAACTGG - Intergenic
1132231722 15:100189475-100189497 GGAGCACCTGAATTAATAAAGGG - Intronic
1133610432 16:7428203-7428225 GGAGAAACTAAATGAATAAAAGG - Intronic
1137714359 16:50589226-50589248 TGAGAAATAGTATTAAAAAGGGG - Intronic
1138714802 16:59008781-59008803 GGAGAAACAGGATTACTGAGAGG - Intergenic
1138896298 16:61209060-61209082 GGAGAAAGAGTATGAATTAGTGG - Intergenic
1140783589 16:78318353-78318375 GGAGAAAATGTATAAAGGAGAGG + Intronic
1140910372 16:79445784-79445806 GGAGCAATTGTAATAATAAAAGG - Intergenic
1141333460 16:83133475-83133497 GGAGAGACTGTATCAAAAATAGG - Intronic
1143614211 17:8039779-8039801 GGAGAAACTGTACTTATGGGAGG + Intronic
1148526357 17:48340238-48340260 GGCGAAACTAACTTAATAAGTGG + Intronic
1149236026 17:54592096-54592118 GAAGAAACTGTATCAATTAATGG - Intergenic
1151170308 17:72240343-72240365 AGAGAAACAGGATTAATATGGGG - Intergenic
1152138335 17:78520609-78520631 GAAGTGATTGTATTAATAAGTGG - Intronic
1153018115 18:602539-602561 GCAGAAACTGTTTTCAGAAGTGG - Intronic
1162819695 19:13214924-13214946 GGAGAAACTGAGTTACTAAGTGG - Intronic
1165275011 19:34742083-34742105 AGAGAAACTGTATGAAGCAGTGG + Exonic
925711736 2:6747749-6747771 GAAGGGACTGTATAAATAAGAGG - Intergenic
926039586 2:9662046-9662068 GGAGAGACCTTATTAATAGGTGG + Intergenic
926366393 2:12137515-12137537 GAAGAAACTGCATTAATTAACGG - Intergenic
928923189 2:36547805-36547827 GAAAAAACTGTATTAATTAAGGG + Intronic
929671125 2:43877014-43877036 GAAGAAACTGTGTGAATATGGGG + Intronic
930345190 2:50171177-50171199 GAAGAAACTCTATGTATAAGTGG + Intronic
931594714 2:63928585-63928607 GAAGAAACTGCATCAATTAGTGG + Intronic
932837971 2:75055167-75055189 GGAGAAATTGAGTGAATAAGTGG - Intronic
935005440 2:99071261-99071283 GGAGAAAGAGTAATTATAAGAGG + Intronic
935273732 2:101458276-101458298 GTAGAAACTGCATCAATTAGTGG - Intronic
937615749 2:123920423-123920445 AGAGAAACAGTACCAATAAGAGG + Intergenic
939972772 2:148680826-148680848 GTAGAAATTGTATTCAGAAGAGG + Intronic
940207108 2:151215195-151215217 GGAGAAAATGTAATAACATGAGG - Intergenic
941504878 2:166330250-166330272 GGAGAAAAAATATTAATAAAAGG - Intronic
941724192 2:168843261-168843283 GGAGAAACTGAAACAATGAGAGG - Intronic
941785374 2:169492096-169492118 CGAGAAAAAGTATTAATAATTGG + Intronic
943629030 2:190230152-190230174 GCAGAAAATGTTTTATTAAGGGG - Intronic
943662358 2:190572527-190572549 GTAGGAACTCTATTACTAAGAGG + Intergenic
943866346 2:192929237-192929259 GAAGAAACTGTATCAATTAATGG - Intergenic
944363169 2:198883008-198883030 AGAGAAACTGCAATAATAAATGG + Intergenic
944433515 2:199661464-199661486 GGAGAGACAGCATTGATAAGTGG + Intergenic
945743313 2:213689893-213689915 GGAGAAAATGAATAAATGAGTGG - Intronic
946696664 2:222366799-222366821 GTAGAAACTGCATTAATTAATGG - Intergenic
947319375 2:228898926-228898948 GGAGAAGATGTATCATTAAGAGG - Intronic
947910475 2:233797621-233797643 GGACAAAATCTATTAAAAAGTGG + Intronic
1170186365 20:13595302-13595324 GAAGAAACTGTATCAATTAACGG + Intronic
1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG + Intronic
1172238696 20:33396815-33396837 GGAGAAGCTGTCTTCAGAAGTGG - Exonic
1173456021 20:43201963-43201985 GGAGAAACCTGATTATTAAGAGG - Intergenic
1174492425 20:50910079-50910101 AGAGAAAGTGAATAAATAAGAGG + Intronic
1175601673 20:60279387-60279409 GGAGGAACTGGATTTATATGTGG + Intergenic
1177931932 21:27296048-27296070 GGAGAAAATGTATGCAAAAGAGG + Intergenic
1178998455 21:37429997-37430019 GGAGAAACTGGATGGAAAAGAGG - Intronic
1182667310 22:31969180-31969202 AGAGAAACTGTACCAGTAAGGGG + Intergenic
1182983130 22:34691057-34691079 GGGGAAACTGTGTTAATGAATGG + Intergenic
1185244933 22:49768502-49768524 GGAGAAACTGTAATGAGATGAGG + Intergenic
949103170 3:170723-170745 GTACAAACTGTATTACTAATTGG + Intergenic
949442442 3:4096914-4096936 AGAGAAACTGGATTATTAGGAGG + Intronic
949715200 3:6921933-6921955 GGAGTTACTGTATTAGAAAGTGG - Intronic
949797328 3:7865153-7865175 GGAGAGACAGTATGAGTAAGAGG + Intergenic
949911895 3:8917960-8917982 GGAGGAGCTTTATTAATATGAGG + Intronic
952144936 3:30522093-30522115 GAAGAAGCTTTATTAATAAAGGG + Intergenic
952807535 3:37370858-37370880 AGAGAAAAAGTATTAATAAATGG - Intergenic
954988034 3:54813023-54813045 GGAGAATGTGTATTCAGAAGGGG - Intronic
955361465 3:58279655-58279677 GAAGAAACTGCATCAATAATGGG - Intronic
955662258 3:61313738-61313760 CAAGAAACAGAATTAATAAGAGG + Intergenic
955795636 3:62633663-62633685 GGAGAAGCTGTTTTAATTAGAGG - Intronic
956331065 3:68109611-68109633 GGAGAAACTGCATGACCAAGAGG + Intronic
956653644 3:71528662-71528684 GGATAAACAAAATTAATAAGGGG + Intronic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
957635743 3:82781504-82781526 AGAAAAACTGTATTATTAACAGG + Intergenic
958126496 3:89363127-89363149 GGAGAAACTTCATTAATATGTGG - Intronic
958548175 3:95583554-95583576 GCATAAACTGAATTTATAAGTGG + Intergenic
959761680 3:109973556-109973578 GGAGAACCTGTATTTATATTGGG + Intergenic
960187994 3:114667822-114667844 GGGAAAAATGTATTAATGAGAGG + Intronic
960437816 3:117648677-117648699 GGAGAAACTGTAGAAATCACTGG - Intergenic
961977741 3:131044174-131044196 GGAGAAACTGCATCAACAAATGG + Intronic
962190975 3:133310788-133310810 GAAGAAACTGTATCAATTAACGG - Intronic
962656179 3:137545765-137545787 GGAGAAACTGCATCAATTAATGG + Intergenic
962717041 3:138135354-138135376 GGACCCACTGTATTAAGAAGGGG + Intergenic
962727564 3:138247367-138247389 AGAGAAACTGAGTTAATGAGTGG + Intronic
964923695 3:161929787-161929809 GGTGAAACTGTTATAATCAGAGG - Intergenic
966983521 3:185159253-185159275 GGAGAAAGTGAATTAAGAAAAGG - Intergenic
967676643 3:192306773-192306795 GGAGAGGCAGTATAAATAAGAGG + Intronic
970167631 4:13256488-13256510 GGAGAAACTGTAGTCTAAAGGGG + Intergenic
970433758 4:16013170-16013192 TGAGAAACTGTTTTTTTAAGAGG + Intronic
970681207 4:18510413-18510435 GCTGAAACTCTATTAAAAAGAGG - Intergenic
971466962 4:26974299-26974321 GAAGAAACTGCATTAATTAACGG - Intronic
971799202 4:31266620-31266642 GGAGAGACTGTTTAAATGAGAGG - Intergenic
971915174 4:32860664-32860686 AGTGAAACTGTTTTAATCAGTGG + Intergenic
972178579 4:36438157-36438179 GAAGAAACTGGATTATTAACAGG - Intergenic
972212551 4:36856305-36856327 GAAGAAACTGCATCAATTAGTGG + Intergenic
973174421 4:47187162-47187184 GTACAAACTGTATTTTTAAGGGG - Intronic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974495339 4:62618510-62618532 GGAGAAAGAGTACTAATAAAAGG + Intergenic
975659818 4:76677264-76677286 GGTTAAACTATTTTAATAAGAGG - Intronic
975750910 4:77522775-77522797 GAAGAAATTGTATCAATAAACGG - Intronic
976113510 4:81701874-81701896 AGAGAAAGTGTATGAATAAACGG - Intronic
976802733 4:89010788-89010810 TGAGAAACTGTGTTAGGAAGGGG - Intronic
977906171 4:102479970-102479992 GAAGAAACTGTATCAATTAATGG + Intergenic
979510501 4:121548739-121548761 GAAGAAACTGTATCAATTAACGG - Intergenic
980452520 4:132993311-132993333 GGAGAAACTGAAATAATAAATGG + Intergenic
980634727 4:135486320-135486342 TGACAGACTGTTTTAATAAGTGG + Intergenic
983103125 4:163650976-163650998 GGGGAAACTGAAGTAAAAAGAGG + Intronic
983196659 4:164814315-164814337 TGAGAAACAGTATTAAAAACTGG + Intergenic
988873319 5:35415060-35415082 GGAGAAACTTGATTAATTGGGGG - Intergenic
989083864 5:37655012-37655034 GAAGAAACTGTATCAATTAACGG - Intronic
990351387 5:54920043-54920065 GAAGAAACTGCATTAACTAGTGG + Intergenic
990601850 5:57366954-57366976 TGAGGAACAGCATTAATAAGTGG + Intergenic
991243605 5:64486003-64486025 GGAGAATCAGTATGCATAAGAGG - Intergenic
992014956 5:72566322-72566344 TGAGAAACTCTTTTAAGAAGAGG - Intergenic
993539687 5:89133492-89133514 GGAGAGACTGAAGTAAAAAGAGG - Intergenic
994160524 5:96551494-96551516 GAAGAAACTGTATCAATTAATGG + Intronic
994426241 5:99591297-99591319 GGAGAATCTGTGTTTCTAAGGGG - Intergenic
994787627 5:104184934-104184956 GCAGAAACTTTATCAATAAATGG + Intergenic
994978395 5:106840807-106840829 GAAGAAACTGCATCAATAACAGG + Intergenic
997560862 5:134845319-134845341 GGAGACACTTTATTAAGCAGTGG - Intronic
997908441 5:137844023-137844045 GGAGAATCTGTAGCATTAAGCGG - Intergenic
997972810 5:138417783-138417805 AGAGAAACTGTACCAATCAGGGG - Intronic
999544948 5:152617279-152617301 GGAAAAAATGTTTTTATAAGAGG - Intergenic
1000221977 5:159223049-159223071 GGAGAAAATGTTTTTAAAAGGGG - Intergenic
1000489273 5:161889456-161889478 GAAGAAAATGTATTAATATTTGG - Intronic
1002116899 5:176969322-176969344 GGACAAACTTTTTTATTAAGAGG + Intronic
1006238462 6:32656948-32656970 GGAGATTCTTTATTAATGAGAGG - Intergenic
1007297555 6:40837748-40837770 GGAATAAATGTATTTATAAGTGG + Intergenic
1011010283 6:82695777-82695799 GGAGACACTGTATTAAGTTGGGG + Intergenic
1012229739 6:96746857-96746879 GGAGAAACTGGACTAATACATGG + Intergenic
1012878639 6:104758625-104758647 GAAGAAACTGCATCAATAAATGG + Intronic
1013280645 6:108633769-108633791 GGAGAAACTGGACTAATGAATGG + Intronic
1014111149 6:117619653-117619675 GGGGAAACTGTGTCAATTAGAGG - Intergenic
1015176229 6:130312034-130312056 GGAGAAACAGTATGAGAAAGAGG + Intronic
1017367262 6:153658437-153658459 GGAGAAACTGGATTAATACAGGG - Intergenic
1018426346 6:163686473-163686495 GGTGAAACTATTTTAATATGAGG + Intergenic
1019120755 6:169801766-169801788 GGGGAAACTGTATTGATTTGGGG + Intergenic
1019793110 7:3030200-3030222 GGAGAAAGGGGATTAATATGGGG - Intronic
1020483363 7:8690294-8690316 GCAGAAAGTCTATTAATAAATGG + Intronic
1020519758 7:9170978-9171000 GGAGTACCTGTATTAATCACAGG + Intergenic
1021484389 7:21151068-21151090 GGAGAGGCACTATTAATAAGAGG + Intergenic
1023090432 7:36612889-36612911 GTAGAAACTCTGTTAATTAGAGG + Intronic
1023651010 7:42369486-42369508 GAAGAAACTGTATCAATTAATGG - Intergenic
1024106933 7:46099391-46099413 TGAGAAATTGGATTAAAAAGAGG + Intergenic
1024139067 7:46443350-46443372 GTTGAAACTATCTTAATAAGAGG + Intergenic
1024772418 7:52738752-52738774 GGAGACAGTGAATTAATCAGTGG - Intergenic
1027108619 7:75420606-75420628 GGATAAAGTGTATAAAAAAGGGG - Intronic
1027843571 7:83343703-83343725 GAAGAAACTGCATTAACAAAAGG + Intergenic
1028819959 7:95197533-95197555 TGAAAAACTGTAATAACAAGAGG - Intronic
1031634036 7:124080294-124080316 GGAGAAACTTTATTCTTATGAGG - Intergenic
1032506025 7:132435359-132435381 TGAGCAACTGTATTAAGTAGTGG - Intronic
1032572064 7:133011035-133011057 GGAAAAACTGTGATAGTAAGAGG + Intronic
1032870606 7:135980504-135980526 GGCAAAACTGTAATAATATGGGG + Intergenic
1035390341 7:158500195-158500217 GGGGAAACTGTAGTAACAATTGG - Intronic
1037652688 8:20853237-20853259 GGAGAAACAGTAGTTATTAGAGG - Intergenic
1038028267 8:23612362-23612384 CTAGAAAATGTATTAAAAAGTGG - Intergenic
1038906167 8:31905494-31905516 GTAGATACTTTATTAATAGGTGG + Intronic
1040473248 8:47754037-47754059 GAAGAAACTGCATCAATTAGTGG + Intergenic
1041426856 8:57730986-57731008 TGAGAAACTATATGAATCAGTGG + Intergenic
1042467095 8:69140665-69140687 GCATCAACTGTAGTAATAAGGGG + Intergenic
1042636200 8:70878231-70878253 GAAGAAACTGCATTAATTAATGG + Intergenic
1043874215 8:85465556-85465578 AGACAAACTGTATTATTAAGAGG - Intronic
1044075741 8:87820637-87820659 TGAGAAACAGTATTATTGAGAGG + Intergenic
1045205199 8:100032093-100032115 GAAGAAACTGTATCAATTAATGG + Intronic
1046346916 8:112941865-112941887 GGAGAAACTGTATTATGATGGGG - Intronic
1046824668 8:118674195-118674217 GGAGAAGCTGCATTAATAAGTGG - Intergenic
1046853358 8:119000969-119000991 GGAGAAAAGGTATTAACAAAAGG + Intronic
1047175226 8:122534504-122534526 GGAGAAAATTTATTATTAAATGG + Intergenic
1047979321 8:130163902-130163924 GTATAAAATGTATTATTAAGAGG + Intronic
1048048689 8:130796861-130796883 GGAGGAAAAGTATGAATAAGAGG - Intronic
1049935393 9:497017-497039 GGAGAAAATGTATTCATACAGGG + Intronic
1052551367 9:29954110-29954132 GGAGAAGCTATATTAATATCAGG - Intergenic
1056572869 9:87831199-87831221 TTAAAAACTGTATTTATAAGTGG + Intergenic
1057485685 9:95481583-95481605 GGAGAGACTTTATTAGTGAGTGG - Intronic
1057762478 9:97888023-97888045 GGAGAAAAGGAATTAATAAGAGG + Intergenic
1058442611 9:105023901-105023923 GGAGAAACTGTCTGCAGAAGAGG - Intergenic
1058569945 9:106330617-106330639 ACAGAAACTTTATTATTAAGGGG + Intergenic
1058803472 9:108567194-108567216 GGAGAGGGTGTCTTAATAAGGGG + Intergenic
1187569852 X:20489797-20489819 TGAGAAACTAAATTAAAAAGTGG - Intergenic
1189662501 X:43316949-43316971 TGAAAAACTGTATTCATAAAAGG + Intergenic
1191886360 X:65892723-65892745 GGAGAAAATGCATCAATAAATGG - Intergenic
1192046679 X:67682680-67682702 GGAGAAATTGAATAAATAATAGG + Intronic
1192611198 X:72569070-72569092 GTAGTGACTCTATTAATAAGGGG + Intronic
1193019750 X:76779148-76779170 GAAGAAACTGCATCAATTAGTGG - Intergenic
1195151620 X:102076826-102076848 GGAGTTAGTGTATTAATAATTGG - Intergenic
1195647072 X:107244860-107244882 GCAGTAACTGTATTAGTCAGAGG + Intergenic
1195810751 X:108825945-108825967 AGAGCCACTGTATTTATAAGTGG - Intergenic
1196631265 X:117942891-117942913 GAAGAAACTGCATCAATAAAGGG - Intronic
1197308745 X:124878073-124878095 GAAGAAAATGTATGTATAAGTGG + Intronic
1197959822 X:131991564-131991586 GAAGAAACTGCATTAATTAATGG + Intergenic
1198111766 X:133508501-133508523 GGAGCAACTGGAGTCATAAGTGG + Intergenic
1198661941 X:138978717-138978739 GGGGAAACTGAAGTAACAAGAGG + Intronic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1199700567 X:150372577-150372599 GAAGAAAATGTAGTAATTAGAGG - Intronic
1200368082 X:155688941-155688963 TGAGCAACTCTATTAAAAAGTGG - Intergenic
1201561298 Y:15320370-15320392 GAAGAAACTGTATCAATTAATGG - Intergenic
1202057134 Y:20846758-20846780 GAAGAAACTGCATTAACTAGTGG - Intergenic