ID: 1074056006

View in Genome Browser
Species Human (GRCh38)
Location 10:109923395-109923417
Sequence AGCCACCGCGAGTAAGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056006_1074056016 26 Left 1074056006 10:109923395-109923417 CCCTCACCTTACTCGCGGTGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1074056016 10:109923444-109923466 CGTGCCCCAGCCCACGTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 112
1074056006_1074056014 24 Left 1074056006 10:109923395-109923417 CCCTCACCTTACTCGCGGTGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1074056014 10:109923442-109923464 GACGTGCCCCAGCCCACGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 83
1074056006_1074056015 25 Left 1074056006 10:109923395-109923417 CCCTCACCTTACTCGCGGTGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1074056015 10:109923443-109923465 ACGTGCCCCAGCCCACGTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1074056006_1074056011 -3 Left 1074056006 10:109923395-109923417 CCCTCACCTTACTCGCGGTGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1074056011 10:109923415-109923437 GCTTTCTGGAGGCTGCCATTCGG 0: 1
1: 0
2: 2
3: 15
4: 199
1074056006_1074056012 0 Left 1074056006 10:109923395-109923417 CCCTCACCTTACTCGCGGTGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1074056012 10:109923418-109923440 TTCTGGAGGCTGCCATTCGGCGG 0: 1
1: 0
2: 1
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056006 Original CRISPR AGCCACCGCGAGTAAGGTGA GGG (reversed) Exonic
900879084 1:5367589-5367611 AGCCACCACGAATAATGAGATGG + Intergenic
903101593 1:21035247-21035269 AGCCACGGCAGGTAAGGTGCAGG - Intronic
903878594 1:26493147-26493169 AGCCACTGAGATCAAGGTGAGGG - Intergenic
915845460 1:159259412-159259434 AGCCGCAGGAAGTAAGGTGAAGG - Intergenic
920089394 1:203441525-203441547 AGCCACAGAGGCTAAGGTGAAGG + Intergenic
920199254 1:204249395-204249417 AGCCACCAAGGGCAAGGTGAAGG - Intronic
1066586659 10:36943733-36943755 AGCCACCGCTAGAGCGGTGAGGG + Intergenic
1067077583 10:43196969-43196991 ATCTACAGCGAGGAAGGTGAGGG - Exonic
1074056006 10:109923395-109923417 AGCCACCGCGAGTAAGGTGAGGG - Exonic
1074547381 10:114411809-114411831 AGCCACCGTGAGTCTGGAGAGGG - Intergenic
1076333765 10:129691458-129691480 AGGCATCGCGAGTAAGAAGAGGG + Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1085296013 11:75432146-75432168 AGCCCCCTAGAGTAAGCTGATGG - Intergenic
1090915521 11:131159305-131159327 AGCCACTGGGAGAAAGGTGTGGG - Intergenic
1095943967 12:47743596-47743618 AGCCTCCGTGAGAGAGGTGATGG - Exonic
1110496008 13:76168598-76168620 AGCCAGAGAAAGTAAGGTGAAGG - Intergenic
1114372210 14:22102361-22102383 ATCCACAGTGAGTAAAGTGAGGG - Intergenic
1124998478 15:34747097-34747119 AGGCACGGCGAGTCAGATGAGGG - Intergenic
1128036330 15:64529656-64529678 AGACACCATGGGTAAGGTGAAGG - Intronic
1129545644 15:76392169-76392191 AGCCACAGCAAGTAAGGTTAAGG - Intronic
1131223918 15:90608137-90608159 GGCCACTGTGAGTAAGGGGATGG + Intronic
1135975189 16:27104092-27104114 AGCCACCACAACTAAGATGAGGG + Intergenic
1141757526 16:86001919-86001941 AGACACAGCGAGTGAGGGGAAGG - Intergenic
1150309830 17:64118986-64119008 AGCCATTGCGAGTGAGGAGAAGG - Intronic
1151624453 17:75267907-75267929 AGCCAGGGAGAGGAAGGTGAAGG + Intronic
1156924635 18:42561059-42561081 AACCACCCCAAGGAAGGTGAGGG + Intergenic
1159497073 18:69220565-69220587 AGCCACGGTGAGGCAGGTGAAGG - Intergenic
1160549455 18:79684105-79684127 AGCCACCTTCACTAAGGTGATGG - Intronic
1163763720 19:19150856-19150878 AGCCACTGAGAGGAAGATGATGG + Intronic
1173734086 20:45347536-45347558 ATCCACCTTGAGTGAGGTGAAGG - Intronic
954431099 3:50471253-50471275 ACGCACCGAGAGTCAGGTGAGGG - Intronic
976272754 4:83247660-83247682 AGCCACAGTGTGTAAGGTGGCGG - Intergenic
985779964 5:1865443-1865465 AGCCACCGCGATTATGATTATGG + Intergenic
1002399984 5:178986325-178986347 AGCCACCATGAGGAAGGTGATGG + Exonic
1010115911 6:72310536-72310558 AGCAACCGAGAGTGATGTGATGG + Intronic
1039889117 8:41672370-41672392 CCCCACCGTGAGTCAGGTGACGG - Exonic
1043232900 8:77824794-77824816 AGCCACATCCAGTAAGTTGAAGG - Intergenic
1045550811 8:103170589-103170611 AGCCACCGCAAGCTAGGAGAGGG + Intronic
1048448051 8:134507400-134507422 AGCCACCGTGAGCGAGGTGCGGG + Intronic
1055721021 9:79174986-79175008 AGCCACCAGGAGCAAGGAGATGG - Intergenic
1056299371 9:85226092-85226114 AGCCTCAGGGAGTAGGGTGAGGG - Intergenic
1196510077 X:116499217-116499239 AGCCACAGGGAGAAAGGAGAGGG - Intergenic