ID: 1074056705

View in Genome Browser
Species Human (GRCh38)
Location 10:109928807-109928829
Sequence CTTTTCCCTCATAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056705_1074056713 14 Left 1074056705 10:109928807-109928829 CCTCCCACCCTATGAGGGAAAAG No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data
1074056705_1074056712 -4 Left 1074056705 10:109928807-109928829 CCTCCCACCCTATGAGGGAAAAG No data
Right 1074056712 10:109928826-109928848 AAAGACTCAGGGAAGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056705 Original CRISPR CTTTTCCCTCATAGGGTGGG AGG (reversed) Intergenic