ID: 1074056706

View in Genome Browser
Species Human (GRCh38)
Location 10:109928810-109928832
Sequence AGTCTTTTCCCTCATAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056706_1074056712 -7 Left 1074056706 10:109928810-109928832 CCCACCCTATGAGGGAAAAGACT No data
Right 1074056712 10:109928826-109928848 AAAGACTCAGGGAAGCTCTATGG No data
1074056706_1074056713 11 Left 1074056706 10:109928810-109928832 CCCACCCTATGAGGGAAAAGACT No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056706 Original CRISPR AGTCTTTTCCCTCATAGGGT GGG (reversed) Intergenic