ID: 1074056707

View in Genome Browser
Species Human (GRCh38)
Location 10:109928811-109928833
Sequence GAGTCTTTTCCCTCATAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056707_1074056712 -8 Left 1074056707 10:109928811-109928833 CCACCCTATGAGGGAAAAGACTC No data
Right 1074056712 10:109928826-109928848 AAAGACTCAGGGAAGCTCTATGG No data
1074056707_1074056713 10 Left 1074056707 10:109928811-109928833 CCACCCTATGAGGGAAAAGACTC No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056707 Original CRISPR GAGTCTTTTCCCTCATAGGG TGG (reversed) Intergenic
No off target data available for this crispr