ID: 1074056708

View in Genome Browser
Species Human (GRCh38)
Location 10:109928814-109928836
Sequence CCTGAGTCTTTTCCCTCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056708_1074056713 7 Left 1074056708 10:109928814-109928836 CCCTATGAGGGAAAAGACTCAGG No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056708 Original CRISPR CCTGAGTCTTTTCCCTCATA GGG (reversed) Intergenic