ID: 1074056710

View in Genome Browser
Species Human (GRCh38)
Location 10:109928815-109928837
Sequence CCCTGAGTCTTTTCCCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056710_1074056713 6 Left 1074056710 10:109928815-109928837 CCTATGAGGGAAAAGACTCAGGG No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056710 Original CRISPR CCCTGAGTCTTTTCCCTCAT AGG (reversed) Intergenic