ID: 1074056712

View in Genome Browser
Species Human (GRCh38)
Location 10:109928826-109928848
Sequence AAAGACTCAGGGAAGCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056705_1074056712 -4 Left 1074056705 10:109928807-109928829 CCTCCCACCCTATGAGGGAAAAG No data
Right 1074056712 10:109928826-109928848 AAAGACTCAGGGAAGCTCTATGG No data
1074056704_1074056712 -3 Left 1074056704 10:109928806-109928828 CCCTCCCACCCTATGAGGGAAAA No data
Right 1074056712 10:109928826-109928848 AAAGACTCAGGGAAGCTCTATGG No data
1074056707_1074056712 -8 Left 1074056707 10:109928811-109928833 CCACCCTATGAGGGAAAAGACTC No data
Right 1074056712 10:109928826-109928848 AAAGACTCAGGGAAGCTCTATGG No data
1074056706_1074056712 -7 Left 1074056706 10:109928810-109928832 CCCACCCTATGAGGGAAAAGACT No data
Right 1074056712 10:109928826-109928848 AAAGACTCAGGGAAGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056712 Original CRISPR AAAGACTCAGGGAAGCTCTA TGG Intergenic