ID: 1074056713

View in Genome Browser
Species Human (GRCh38)
Location 10:109928844-109928866
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074056708_1074056713 7 Left 1074056708 10:109928814-109928836 CCCTATGAGGGAAAAGACTCAGG No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data
1074056704_1074056713 15 Left 1074056704 10:109928806-109928828 CCCTCCCACCCTATGAGGGAAAA No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data
1074056705_1074056713 14 Left 1074056705 10:109928807-109928829 CCTCCCACCCTATGAGGGAAAAG No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data
1074056710_1074056713 6 Left 1074056710 10:109928815-109928837 CCTATGAGGGAAAAGACTCAGGG No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data
1074056707_1074056713 10 Left 1074056707 10:109928811-109928833 CCACCCTATGAGGGAAAAGACTC No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data
1074056706_1074056713 11 Left 1074056706 10:109928810-109928832 CCCACCCTATGAGGGAAAAGACT No data
Right 1074056713 10:109928844-109928866 TATGGCAGTCTCTTCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074056713 Original CRISPR TATGGCAGTCTCTTCCTTTA AGG Intergenic
No off target data available for this crispr