ID: 1074058896

View in Genome Browser
Species Human (GRCh38)
Location 10:109946948-109946970
Sequence GAAGATGCACAGATGAATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074058896 Original CRISPR GAAGATGCACAGATGAATCG TGG (reversed) Intronic
909291772 1:73891751-73891773 CAAGATGCAGAGATCAAACGCGG + Intergenic
909390879 1:75120206-75120228 GAAGATGCATAGAAGAATTAAGG + Intergenic
912903197 1:113675033-113675055 GAAAATGCGTAGATGAATAGAGG + Intronic
913019035 1:114768002-114768024 CAAGATGCACCAATGAATAGTGG - Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
915705251 1:157837584-157837606 GAAGATGAACAGCTTAATAGGGG + Intronic
922463600 1:225831016-225831038 GCCAATGCACAGATGAATGGGGG - Intronic
922463609 1:225831079-225831101 GCCAATGCACAGATGAATGGGGG - Intronic
924384101 1:243487143-243487165 GCAGGTGCTCAGATGAATGGTGG + Intronic
1067764195 10:49072831-49072853 GAAGACACACAGATGACTCCAGG + Intronic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1075514475 10:123098128-123098150 GAAGATACACAGATACATGGAGG + Intergenic
1076514356 10:131034950-131034972 GAAAATGGAGAGATAAATCGTGG - Intergenic
1076900644 10:133335900-133335922 GCAGATGGACAGATGGATGGCGG + Intronic
1078053215 11:7985275-7985297 GAAGAAGCAGAGATGAATTGGGG - Intronic
1080210779 11:29782383-29782405 GAATAAGCACAGATGGATCCTGG + Intergenic
1081236547 11:40654020-40654042 GAGGGTGCACAGAAGAATTGAGG + Intronic
1089262443 11:117232261-117232283 GAAGATGCCCCGAGGACTCGGGG - Exonic
1089389259 11:118088915-118088937 GAAGATGCAAAGCTGAAACAAGG - Intronic
1090917903 11:131182407-131182429 GGAGATACACAGATGAGTTGAGG - Intergenic
1091674471 12:2478861-2478883 GAAGATGCACAAGTGAATGATGG + Intronic
1093149642 12:15605742-15605764 GAAGATGCAGAGAGGAGTCCGGG - Intergenic
1093163983 12:15784353-15784375 GAAGATGTACAGATGAAAAGGGG + Intronic
1097058683 12:56266756-56266778 GAAGCTGCAAAGATGGTTCGGGG - Intergenic
1101055431 12:100907527-100907549 GAAGATACAAAGATGAATTGAGG - Intronic
1102215848 12:111160900-111160922 GAAGATGCAGGGAGGAATAGCGG + Intronic
1105956238 13:25285989-25286011 GAAGGTGCACAGAGGAAAAGAGG - Intronic
1107061607 13:36165618-36165640 GGAGATGCACAGAAGAAAAGGGG + Intergenic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1109656391 13:65396555-65396577 GAAGAAGCACACATGAATCATGG - Intergenic
1113598559 13:111551710-111551732 GTAGATGAAGAGATGAATGGGGG - Intergenic
1114887813 14:26876501-26876523 GAAGACTCACAGATGCATAGAGG + Intergenic
1117045086 14:51805475-51805497 GAAGATACACAGATAAATTTTGG - Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1123466498 15:20520270-20520292 GAAACTGCACAGATGAGTTGGGG + Intergenic
1123651616 15:22480767-22480789 GAAACTGCACAGATGAGTTGGGG - Intergenic
1125537401 15:40449924-40449946 GAAGATGCACAGTGGACTCCTGG + Intronic
1126560609 15:50039640-50039662 CTACATGCACAGATGAATAGGGG + Intronic
1131085040 15:89568756-89568778 GAAGATGCAGAGGTGAGTCTGGG - Intergenic
1132205023 15:99980536-99980558 GAAACTGCACAGATGGATGGAGG + Intronic
1137273762 16:46919904-46919926 GAAGAGTCAAAGATGAATCCTGG + Intronic
1139898086 16:70304336-70304358 AAAGATGAACAGATGAACCTCGG - Intronic
1141254452 16:82387581-82387603 GAAGATGGAGAGATGAGTAGAGG - Intergenic
1142124039 16:88401419-88401441 GATGATGGACAGATGGATAGAGG + Intergenic
1142478531 17:204242-204264 GAGGATGGACAGATGAACAGAGG - Intergenic
1143015791 17:3890518-3890540 GAAGATGCTGAGTTGAATCTGGG - Intronic
1143847046 17:9780168-9780190 GAAGAAGCAGAGATGATTCTGGG + Intronic
1146565589 17:33910166-33910188 TAAGATGCAAAGATGAATAAGGG + Intronic
1149530554 17:57391593-57391615 GAAGATGCACAGATGACTCACGG - Intronic
1151551280 17:74823858-74823880 CAAGGTGCACAGTTGGATCGAGG + Intronic
1155568646 18:27165323-27165345 GAAGCTGCACAGCTAAATCGTGG + Intronic
1161177474 19:2854636-2854658 GGAGATGGACAGATGCATAGGGG + Exonic
1164481807 19:28617156-28617178 GAAGATGAACAGAGAGATCGAGG + Intergenic
1164724429 19:30456739-30456761 GGAGATGCAAAGATGAGTAGAGG + Intronic
926989500 2:18662421-18662443 GAATATACACACATGAATCATGG - Intergenic
934566523 2:95344580-95344602 GAAGATGCTCAGAAGCATCCAGG + Intronic
935641686 2:105296843-105296865 GAAGATGCAGAGTTCAATCAGGG + Intronic
936985492 2:118308539-118308561 GAAGGTTCACAGAGGAATGGAGG + Intergenic
937788051 2:125925429-125925451 AAAGATGAACAGATGAATTCCGG + Intergenic
943963626 2:194301522-194301544 AATGATGCACAGATGACTCCAGG + Intergenic
945163535 2:206918518-206918540 GCAGATGCACAGATGCATAAGGG - Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
946802278 2:223431667-223431689 GAAGCTGGACAGATGACTTGGGG + Intergenic
948082250 2:235215926-235215948 GAAGATGAACAGATTATTCAGGG + Intergenic
1171256575 20:23693211-23693233 GAAGAACCACATATGAATGGAGG + Intergenic
1171263931 20:23755143-23755165 GAAGAACCACATATGAATGGAGG + Intergenic
1171273128 20:23831989-23832011 GAAGAACCACATATGAATGGAGG + Intergenic
1173561040 20:44005970-44005992 GAAGGTGCACAGGTGACTCCTGG + Intronic
1178610681 21:34076081-34076103 CAAGATGCACAAATGATTTGGGG - Intronic
1181536887 22:23550959-23550981 AAAGATGGAAAGATGAAGCGTGG - Intergenic
1182551356 22:31102517-31102539 GAAGGAGCACAGATGAGTGGCGG + Intronic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
949484018 3:4520078-4520100 GAGGCAGCACAGATGAATGGAGG + Intronic
949649423 3:6138650-6138672 GAAGATTTACAGATCAATCAGGG - Intergenic
950217236 3:11168381-11168403 GATGACGCACAGAGGAAGCGGGG + Intronic
952626161 3:35406507-35406529 GAAGAAGAACAGATGCATTGAGG + Intergenic
952870163 3:37892081-37892103 GGAGATGCATAGATGAATTAAGG - Intronic
953441939 3:42925715-42925737 GGTGAAGCACAGATGAATCTAGG - Intronic
954676596 3:52319197-52319219 GAAGAGACACAGATGAATAGGGG - Intronic
955341662 3:58129948-58129970 GATGAAGCACAGAGGAGTCGAGG - Intronic
955927450 3:64022382-64022404 GAAGATGCAGAGAAGAATCTAGG - Exonic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959575051 3:107925298-107925320 GGAGACACACAGATGAATGGCGG - Intergenic
961635582 3:128330747-128330769 GGAGATGCACTGAGGAAGCGGGG - Intronic
964684008 3:159375256-159375278 GAAGATGCTCAGATGAGCCCAGG + Intronic
970602226 4:17649785-17649807 GTAGATGGATAGATGAATGGTGG - Intronic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
972698283 4:41469079-41469101 GTGGATGCACAGATGACTCTTGG - Intronic
976928290 4:90530148-90530170 GGAGATGCCAAGATGAATAGGGG + Intronic
978608479 4:110508978-110509000 GAAAATGCTCAGATGATTAGTGG - Intronic
979440015 4:120740534-120740556 GAGGAGTCACAGATGAATCTAGG - Intronic
984329691 4:178298574-178298596 GTAGATGCAGAGATGAAGTGTGG - Intergenic
984395293 4:179190289-179190311 GGTGATGCAAAGATGATTCGTGG - Intergenic
985620842 5:954365-954387 AAAGATGCACAGAACAATTGAGG - Intergenic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
987111624 5:14693083-14693105 GAAGATGCACAGGTGGCTCCTGG + Exonic
987333011 5:16873685-16873707 GCAGGTGCACAGAAGAATTGAGG - Intronic
994382490 5:99087858-99087880 GAAGATGCTCATATGCATGGGGG + Intergenic
997063193 5:130531584-130531606 GAAGATCCTCATATGAATCTTGG - Intergenic
1000115702 5:158151626-158151648 GAAGATATACACAGGAATCGAGG + Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1004559632 6:16735465-16735487 GAAGATGCCCAAATGAATGGAGG + Intronic
1005750394 6:28876495-28876517 GAGGAAGCACAGATGCATTGGGG - Intergenic
1013821169 6:114154885-114154907 GAAGATGCCCAGATGATGGGAGG - Intronic
1017758242 6:157548211-157548233 AAAGATGCAAATATGAATTGGGG - Intronic
1018020248 6:159756147-159756169 GAAAATGCACAGATGTATGGTGG - Exonic
1022161580 7:27715987-27716009 GAAGAAGCACAAAAGAAGCGTGG + Intergenic
1023122990 7:36928180-36928202 GAAGATGCACTTACGAATCCGGG - Intronic
1023229645 7:38013198-38013220 GATGAAGCACAGATGATTTGGGG - Intronic
1024510713 7:50202595-50202617 GAAGCTGCACAGATGAGCTGAGG - Intergenic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028848013 7:95504471-95504493 GAAGATGAAAAGATGGAACGCGG - Intronic
1030452174 7:109725687-109725709 GAAGATACACAGATGAAAATTGG - Intergenic
1031077333 7:117225536-117225558 GAAGATGCAGAGAAGACTCTGGG - Intronic
1031998216 7:128246760-128246782 GGAGCTGCACAGATGAAATGTGG - Intronic
1032736205 7:134694762-134694784 GAAGATGACCAGAAGAATCTGGG - Intergenic
1035175502 7:157047167-157047189 GAAGAAGCACAGATGACCCTCGG + Intergenic
1039511371 8:38094733-38094755 GCAGGTGCACAGAAGAATTGAGG + Intergenic
1045173829 8:99698456-99698478 CAAGATTCACAGATGAACAGAGG - Intronic
1047257693 8:123228076-123228098 GAGGATGCACAGGTGGATGGTGG - Intronic
1049930061 9:447724-447746 GAACAAACACAGATGAATTGTGG + Intronic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1051350580 9:16194804-16194826 GGAGATGAACAGATGACTGGAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056693445 9:88827215-88827237 GAAGATGGACAGGTGAATTTAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1061059759 9:128244607-128244629 GAGGAGGCACAGATGGATGGGGG - Intronic
1061559115 9:131391447-131391469 TGAGATGCAGAGATGAATCCTGG - Intergenic
1185467566 X:363687-363709 GAAGATGCACTGTGGGATCGCGG - Intronic
1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG + Intergenic
1194542022 X:95185774-95185796 GAAGACACACAAATGAATTGTGG - Intergenic
1197304332 X:124822248-124822270 GAACATGAAGAGATGAATCCTGG + Intronic
1201688114 Y:16730083-16730105 GTAGATGCAGAGATAAATGGTGG + Intergenic