ID: 1074060173

View in Genome Browser
Species Human (GRCh38)
Location 10:109958190-109958212
Sequence GTTTCTGAGCAGAGGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074060168_1074060173 15 Left 1074060168 10:109958152-109958174 CCTTTGTAAAAGTATGAGAACAC No data
Right 1074060173 10:109958190-109958212 GTTTCTGAGCAGAGGTATGTAGG No data
1074060167_1074060173 16 Left 1074060167 10:109958151-109958173 CCCTTTGTAAAAGTATGAGAACA No data
Right 1074060173 10:109958190-109958212 GTTTCTGAGCAGAGGTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074060173 Original CRISPR GTTTCTGAGCAGAGGTATGT AGG Intergenic
No off target data available for this crispr