ID: 1074065248

View in Genome Browser
Species Human (GRCh38)
Location 10:110007825-110007847
Sequence TCTTGGGCTCCGAAGCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074065248_1074065253 -9 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065253 10:110007839-110007861 AGCCCAAGAGGCGGGGCCAGAGG 0: 1
1: 0
2: 4
3: 31
4: 310
1074065248_1074065256 -3 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065256 10:110007845-110007867 AGAGGCGGGGCCAGAGGCGTAGG 0: 1
1: 0
2: 5
3: 35
4: 381
1074065248_1074065257 -2 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065257 10:110007846-110007868 GAGGCGGGGCCAGAGGCGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 211
1074065248_1074065266 21 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065266 10:110007869-110007891 GGCTGCGAGGGGCGGACCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 121
1074065248_1074065265 20 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065265 10:110007868-110007890 GGGCTGCGAGGGGCGGACCTTGG 0: 1
1: 0
2: 1
3: 32
4: 288
1074065248_1074065263 10 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065263 10:110007858-110007880 GAGGCGTAGGGGGCTGCGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 420
1074065248_1074065268 23 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065268 10:110007871-110007893 CTGCGAGGGGCGGACCTTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 130
1074065248_1074065262 9 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065262 10:110007857-110007879 AGAGGCGTAGGGGGCTGCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 177
1074065248_1074065258 -1 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065258 10:110007847-110007869 AGGCGGGGCCAGAGGCGTAGGGG 0: 1
1: 0
2: 4
3: 24
4: 206
1074065248_1074065259 0 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065259 10:110007848-110007870 GGCGGGGCCAGAGGCGTAGGGGG 0: 1
1: 0
2: 3
3: 55
4: 530
1074065248_1074065261 8 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065261 10:110007856-110007878 CAGAGGCGTAGGGGGCTGCGAGG 0: 1
1: 0
2: 1
3: 23
4: 243
1074065248_1074065264 13 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065264 10:110007861-110007883 GCGTAGGGGGCTGCGAGGGGCGG 0: 1
1: 0
2: 0
3: 44
4: 362
1074065248_1074065267 22 Left 1074065248 10:110007825-110007847 CCGGGAGGCTTCGGAGCCCAAGA 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1074065267 10:110007870-110007892 GCTGCGAGGGGCGGACCTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074065248 Original CRISPR TCTTGGGCTCCGAAGCCTCC CGG (reversed) Intronic
900013083 1:132694-132716 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900043149 1:488681-488703 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900064586 1:723678-723700 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900439049 1:2644275-2644297 TCTGCCGCTCCGAGGCCTCCAGG + Exonic
900569870 1:3352956-3352978 GCATGGGCCCCGAAGCCTGCAGG - Intronic
902366007 1:15975010-15975032 TCTGGGGGACAGAAGCCTCCCGG + Intronic
903183379 1:21616533-21616555 TCGTGGGCTCTGGAGCCTCGTGG - Intronic
903226436 1:21896504-21896526 GGTTGGGCTCTGAAGCCTCCAGG - Intronic
904137366 1:28323846-28323868 TCTTGGACTTCCCAGCCTCCGGG + Intergenic
905491526 1:38347962-38347984 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
908477974 1:64507539-64507561 GCATGGGCTCTAAAGCCTCCAGG + Intronic
909301691 1:74020788-74020810 TATTGGACTCCCAAGCCTCTAGG - Intergenic
913655341 1:120954825-120954847 GCTTGGGCTCCTAAGACACCAGG - Intergenic
914081684 1:144415898-144415920 GCTAGGGCTCCGAAGACACCAGG + Intergenic
914176589 1:145284431-145284453 GCTAGGGCTCCGAAGACACCAGG + Intergenic
914508609 1:148310373-148310395 TCCAGGGCTGCCAAGCCTCCAGG + Intergenic
914531318 1:148525910-148525932 GCTAGGGCTCCGAAGACACCAGG + Intergenic
914637075 1:149561830-149561852 GCTAGGGCTCCGAAGACACCAGG - Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916069636 1:161162357-161162379 TCTTGGGCTCGGCCTCCTCCAGG - Exonic
916738018 1:167625253-167625275 TCTTGGACTTCACAGCCTCCAGG + Intergenic
921989614 1:221350476-221350498 TCTTGGACTTCCAAGCCTCCAGG - Intergenic
922099484 1:222469694-222469716 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
922254976 1:223885866-223885888 CCTTAGGCTCCCCAGCCTCCAGG - Intergenic
922261522 1:223949190-223949212 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
922735556 1:227976554-227976576 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
922765447 1:228154232-228154254 TCTTGGTTTCGGCAGCCTCCTGG + Intronic
924342685 1:243051366-243051388 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1063272556 10:4527522-4527544 TCTTAGACTCCTCAGCCTCCAGG - Intergenic
1063375716 10:5553159-5553181 TCTTGGGACTCGAAGCTTCCTGG - Intergenic
1066174557 10:32890550-32890572 TCTTGGACTTCTCAGCCTCCAGG - Intergenic
1066733794 10:38454188-38454210 TCCTGGGCTTCGAAGGCTCCCGG + Intergenic
1067302455 10:45024589-45024611 TCTTGGGGTCCTATGCTTCCTGG + Intergenic
1068003775 10:51369056-51369078 CCTTGGGCTTCGAAATCTCCAGG - Intronic
1068906378 10:62328855-62328877 TCTTTGAATCCGTAGCCTCCAGG - Intergenic
1070077601 10:73153166-73153188 CCTTGGCCTCCCAAACCTCCTGG + Intronic
1072230556 10:93410900-93410922 TCTTGGGCTCTGAAGCCACGTGG + Intronic
1073142170 10:101255319-101255341 TCTTGGGCTCTGAAGCATTTGGG - Intergenic
1073293658 10:102425505-102425527 TCTTGGGGTCACATGCCTCCTGG + Intronic
1074065248 10:110007825-110007847 TCTTGGGCTCCGAAGCCTCCCGG - Intronic
1075332855 10:121585873-121585895 TCTTGTCCTGCTAAGCCTCCTGG - Intronic
1076124548 10:127963455-127963477 TGTTGGGCTCTGAAGACACCAGG - Intronic
1076688108 10:132207274-132207296 TCCTGGGCTCCTCTGCCTCCAGG + Intergenic
1076969420 11:124898-124920 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1079416856 11:20245792-20245814 TCTTGGACTCTAAAACCTCCAGG + Intergenic
1079686442 11:23364722-23364744 TCTTGAACTCCCAAGCCTACAGG - Intergenic
1079879210 11:25903496-25903518 TCTTGGACTTCTCAGCCTCCAGG + Intergenic
1080652886 11:34236614-34236636 CCTTGGGCCCTGAGGCCTCCCGG - Intronic
1080890585 11:36405742-36405764 TCTTGGACTTCCCAGCCTCCAGG - Intronic
1083294215 11:61706576-61706598 TCATGGGCTCTGAGGCCTCCTGG - Intronic
1083891901 11:65599727-65599749 TCTTGGGCTCCTCGGGCTCCAGG + Exonic
1084561371 11:69907349-69907371 TCTTGGGCTCAGAATCCCCCAGG - Intergenic
1084576876 11:69994196-69994218 TCTTGGTCTCAGAAGACTCCTGG + Intergenic
1084659582 11:70538938-70538960 ACGTGGGCTAGGAAGCCTCCTGG + Intronic
1088241503 11:107778009-107778031 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
1088434302 11:109794173-109794195 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
1089639525 11:119838621-119838643 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
1090762459 11:129849437-129849459 TGTTGGGCCCCCAAGGCTCCAGG + Intronic
1091218271 11:133916782-133916804 TCTAGGGCTCCCACACCTCCGGG + Intronic
1096516948 12:52161820-52161842 TCTCGGACTCCCCAGCCTCCAGG - Intergenic
1096924901 12:55133256-55133278 CCTTGTTCTCAGAAGCCTCCAGG - Intergenic
1097341035 12:58438626-58438648 TCTTGGACTTCTCAGCCTCCAGG - Intergenic
1098428353 12:70391554-70391576 CCTTGGCCTCCGAAGGCTCTAGG + Intronic
1100218280 12:92476621-92476643 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
1100462858 12:94818333-94818355 TCTTGGGATCAGCAGCCTGCAGG - Intergenic
1100702536 12:97163491-97163513 TCTTGGATTCCCCAGCCTCCAGG + Intergenic
1101178278 12:102180450-102180472 TCTTGGCCTCCTAAAGCTCCGGG - Intronic
1101237261 12:102802297-102802319 TCCTGGGCTCCTTTGCCTCCAGG + Intergenic
1102074419 12:110048444-110048466 CCTTGGCCTCTGCAGCCTCCTGG - Intronic
1102801752 12:115741318-115741340 CCTTGGGCTCCGATGCACCCAGG - Intergenic
1104535250 12:129612398-129612420 TCTTGGTCCCCCAAGCGTCCAGG - Intronic
1105538996 13:21298278-21298300 GCTCTGGCTCCGAAGCCGCCCGG - Intergenic
1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG + Intergenic
1107881618 13:44837063-44837085 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
1107948839 13:45444048-45444070 TCTTGGACTCCCCAGTCTCCAGG + Intergenic
1109459304 13:62634150-62634172 TCTTGTGCTTCCCAGCCTCCAGG + Intergenic
1113031614 13:105999617-105999639 TCTTGGACTTTGCAGCCTCCAGG - Intergenic
1113440799 13:110326614-110326636 TCTTGGGCCCTGCAGCCTTCAGG + Intronic
1113778046 13:112960179-112960201 TCTTGGGCTTCCAAGCCTCCAGG - Intronic
1114951204 14:27756435-27756457 TCTTGGACTCCCTAGCCGCCAGG - Intergenic
1121728602 14:96171005-96171027 TCCTCGGCTCAGAACCCTCCAGG + Intergenic
1121819693 14:96956470-96956492 TCCAGTGCTCCGTAGCCTCCTGG + Intergenic
1124158456 15:27248947-27248969 TCTCGGGGTCCTCAGCCTCCGGG - Intronic
1125191972 15:37003939-37003961 TCTTGGACTTCCCAGCCTCCAGG + Intronic
1128235304 15:66063249-66063271 TCTTCTGCTCAAAAGCCTCCAGG - Intronic
1129812828 15:78524454-78524476 TCTTGTCCTCCTAACCCTCCAGG + Intronic
1129949905 15:79576417-79576439 TCTTGGCCACAGAAGCCTCCTGG - Intergenic
1130655026 15:85786444-85786466 TCATGGGGCCCGATGCCTCCTGG + Intronic
1131814622 15:96209330-96209352 TGTTGTGCTATGAAGCCTCCTGG - Intergenic
1133201525 16:4207082-4207104 CCTGGGGCTCCCCAGCCTCCTGG + Intronic
1134634656 16:15783256-15783278 AGTTGGGCCCCGAGGCCTCCAGG + Intronic
1137330854 16:47494035-47494057 TGTTGGGATCTGAATCCTCCTGG - Intronic
1140524226 16:75608944-75608966 TCTTGAACTCCGAAGCCTTTTGG + Exonic
1141445951 16:84058446-84058468 TCTTGCCCTCCGAGGCCCCCTGG - Intronic
1142451252 16:90174224-90174246 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1142507912 17:377121-377143 TCTTGGACTCCCCAGCCTCCAGG - Intronic
1143411829 17:6713738-6713760 TCCTGGGCTCTGAAGGGTCCCGG + Intergenic
1146684175 17:34829294-34829316 TCTTGGACTTCTCAGCCTCCAGG + Intergenic
1149599145 17:57882026-57882048 TTTTGGGCTCTGCAGCCTCCTGG + Intronic
1149605993 17:57925686-57925708 TCTGGGGCACAGGAGCCTCCTGG + Intronic
1151893969 17:76967895-76967917 ACTTGAGCTCCTCAGCCTCCTGG - Intergenic
1152281925 17:79389973-79389995 TCCGGGTCTCCGCAGCCTCCAGG + Intronic
1152281929 17:79389990-79390012 TCCAGGTCTCCGCAGCCTCCAGG + Intronic
1152281933 17:79390007-79390029 TCCAGGTCTCCGCAGCCTCCAGG + Intronic
1152281937 17:79390024-79390046 TCCAGGTCTCCGTAGCCTCCAGG + Intronic
1152281952 17:79390075-79390097 TCCGGGTCTCCGCAGCCTCCGGG + Intronic
1152797052 17:82313692-82313714 TCAGGGGCTCCGGAGCCTCTGGG + Intergenic
1153275885 18:3367458-3367480 TCTTGGACTCCTCAGCCTCTAGG - Intergenic
1153805539 18:8706084-8706106 TCCCGGGCTGGGAAGCCTCCCGG + Intronic
1156044695 18:32864401-32864423 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
1157576290 18:48746100-48746122 TCCTGGGCTGTGGAGCCTCCAGG - Intronic
1158049082 18:53193656-53193678 TCTTGGGCATCAAAGCATCCCGG + Intronic
1158982168 18:62773819-62773841 TCTTGGACTTCCCAGCCTCCAGG - Intronic
1160646225 19:194824-194846 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1160768691 19:821116-821138 GCGTGGGCTCCGAAGCCTCAGGG - Intronic
1161719528 19:5895292-5895314 TCTCCTGCTCCGAAGCCTCCGGG + Intronic
1162522367 19:11189205-11189227 TTTTGGCCTCCGAAAGCTCCAGG + Intronic
1163595933 19:18221007-18221029 GCTGGGGCTCCGGCGCCTCCAGG - Intronic
1164273471 19:23695150-23695172 TCTTGGCCTCCCAAGCTGCCAGG - Intergenic
1164868047 19:31621150-31621172 TCTTGGACTTCTCAGCCTCCAGG + Intergenic
1165363788 19:35351883-35351905 CCTTGGGCTACCAAGCCTTCCGG + Exonic
1166001694 19:39881318-39881340 TCTTGGGCATAGAGGCCTCCAGG - Intronic
1166004476 19:39897569-39897591 TCTTGGGCACAGAGGCCTCCAGG - Intronic
1166288842 19:41848846-41848868 TCCTGGACTCCGGTGCCTCCTGG + Exonic
1166293867 19:41879476-41879498 TCTTGCCCTCCCTAGCCTCCTGG - Intronic
1166503743 19:43358956-43358978 TCCTCTGCTCCGAAGACTCCAGG - Intronic
1166506711 19:43375802-43375824 TCCTCTGCTCCGAAGACTCCAGG + Intergenic
927057035 2:19374924-19374946 TCTTGGACTCCCCAGCCTCTAGG - Intergenic
927978354 2:27357208-27357230 CCTTGGGCTCGGACGCCGCCAGG - Intergenic
930056240 2:47254202-47254224 TCTTGGGCTCCAGAGGCCCCTGG - Intergenic
931562729 2:63580067-63580089 TCTTGGACTTCCAAGCCTCCAGG + Intronic
932460301 2:71877903-71877925 TCTTGGACTTCCTAGCCTCCAGG + Intergenic
933270987 2:80232672-80232694 TCTTGGAGTCCAAAGCATCCCGG + Intronic
942454580 2:176129479-176129501 TCATTTGCTCCGCAGCCTCCTGG + Intergenic
943812946 2:192212222-192212244 TCTTGGACTTCCTAGCCTCCAGG - Intergenic
945139314 2:206667115-206667137 TCTTCTGCTCAGAACCCTCCAGG + Intronic
945858166 2:215092076-215092098 TGATGGCCTCAGAAGCCTCCTGG + Intronic
948215954 2:236231563-236231585 TCTTGGACTTCCCAGCCTCCAGG + Intronic
948263733 2:236622752-236622774 TTTGGGGCCCAGAAGCCTCCTGG + Intergenic
948511319 2:238467098-238467120 TCTTGAACTCCCCAGCCTCCAGG - Intergenic
948930820 2:241130803-241130825 TCCTCGGAACCGAAGCCTCCTGG - Intronic
1170955645 20:20977247-20977269 GATTGGGCTCCGAAGCCCCCAGG + Intergenic
1172557730 20:35857057-35857079 TCTTCGGCTCCCAGGCCTCAGGG + Intronic
1172859129 20:38033668-38033690 TCTAGAGCTCCGACGCCTCTCGG + Exonic
1173295434 20:41751203-41751225 TCTTGGACTTGGCAGCCTCCAGG + Intergenic
1174099231 20:48114479-48114501 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
1175316740 20:58053970-58053992 GCTGGGGCTCCTTAGCCTCCTGG - Intergenic
1175891811 20:62319068-62319090 TCTTGGGCTTGGAAGCCAGCAGG - Intronic
1175904423 20:62372493-62372515 TCCTGGGCTTCGAGGCCTTCTGG - Intergenic
1176099013 20:63356564-63356586 TCCTGGGCTCGGCTGCCTCCAGG - Intronic
1176279281 20:64291392-64291414 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1177375792 21:20269619-20269641 TCTTGGTCTTCCCAGCCTCCAGG - Intergenic
1177636294 21:23790801-23790823 TCTTGAGCTTCCCAGCCTCCTGG + Intergenic
1181581508 22:23831427-23831449 TCACGGGCTTCGAAGCCGCCAGG - Intronic
1181852087 22:25756653-25756675 TCTTGGGCTCACCAGCTTCCAGG + Intronic
1183022261 22:35036816-35036838 TCTTGGCCTTCCAAGCCTTCAGG - Intergenic
1184536952 22:45093993-45094015 TCTTGGCCTCTGCAGCCTCAGGG - Intergenic
952748276 3:36802612-36802634 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
952773137 3:37020426-37020448 TCCTGGGCTCCAATTCCTCCAGG + Exonic
953599389 3:44348245-44348267 TGATGGCCTCGGAAGCCTCCTGG - Intronic
955103069 3:55870700-55870722 CCTTGGGCTCCTTAGCCCCCTGG - Intronic
956158351 3:66321903-66321925 TCTTGGACTTCCTAGCCTCCAGG - Intronic
957684356 3:83481531-83481553 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
961990016 3:131179239-131179261 TCTTGGACTTCCCAGCCTCCAGG + Intronic
962322772 3:134405630-134405652 TCTTGGGATCTGGAGCCTCTGGG + Intergenic
962685463 3:137843305-137843327 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
964984279 3:162719784-162719806 TCTTGGACTTCCAACCCTCCAGG + Intergenic
965567210 3:170132662-170132684 TCTTGGGCTTTCCAGCCTCCAGG + Intronic
967330200 3:188282558-188282580 TCTTGGCCTCCCAATGCTCCTGG + Intronic
967911374 3:194545233-194545255 TCTTGGACTTCCCAGCCTCCTGG - Intergenic
968371456 3:198224702-198224724 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
969091158 4:4694909-4694931 TTTTGGGCTTCTGAGCCTCCAGG + Intergenic
970343264 4:15128760-15128782 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
970343639 4:15131859-15131881 TCTTGGGCTTTCAAGACTCCAGG + Intergenic
970642311 4:18080723-18080745 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
972181625 4:36474039-36474061 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
977644970 4:99402095-99402117 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
977873859 4:102125925-102125947 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
978650504 4:110998310-110998332 TCTTGGGTCCAGAAGCATCCCGG + Intergenic
979260142 4:118637175-118637197 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
979328233 4:119403453-119403475 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
979643782 4:123042223-123042245 TCTTGGACTTCCCAGCCTCCAGG - Intronic
981629308 4:146799989-146800011 TCATGGGCTCTTAAGCCTTCTGG + Intronic
986296733 5:6445754-6445776 TCCTGGGTTCAGAATCCTCCTGG + Intergenic
986439579 5:7768070-7768092 TCAAGGCCTCAGAAGCCTCCAGG - Intronic
986447561 5:7835923-7835945 ACTTGGACTTCGCAGCCTCCAGG - Intronic
986502101 5:8411618-8411640 TCTTGGACTTCTCAGCCTCCAGG - Intergenic
987173115 5:15279371-15279393 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
988599200 5:32623846-32623868 TCTTGGGCTCATCAGCCTCCAGG + Intergenic
990265457 5:54070515-54070537 CCTTGGGCTTCCCAGCCTCCAGG + Intronic
992444098 5:76819175-76819197 GCTGGGGCTCCGCATCCTCCTGG - Exonic
993168719 5:84388002-84388024 TCTTGGACTTCTCAGCCTCCAGG + Intergenic
993646937 5:90474130-90474152 CCTGGGGCTGCGCAGCCTCCCGG - Exonic
997994545 5:138575262-138575284 TCGTGGGCGCCGCAGCCTCCCGG - Exonic
998528465 5:142863740-142863762 TCTCGGGCTCCCAGGCCTGCTGG + Intronic
998550969 5:143077815-143077837 TCTTGGCCTTCGAACCCTCTAGG - Intronic
1000336628 5:160246120-160246142 TCTTGCACTCCGAAGCCACTGGG + Intergenic
1000433043 5:161174042-161174064 TCTTGGGCTTCCCAGACTCCAGG - Intergenic
1001021752 5:168188977-168188999 TCTTGGACTTCCCAGCCTCCAGG - Intronic
1001824513 5:174734623-174734645 TCCCTGGCTCCGAAGACTCCAGG + Intergenic
1001825959 5:174745289-174745311 TCTTGGACTTCTCAGCCTCCAGG - Intergenic
1002421077 5:179149344-179149366 CCTTGGGCTTCCCAGCCTCCAGG + Intronic
1002730694 5:181330248-181330270 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1002753836 6:143856-143878 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1005495559 6:26384854-26384876 TCTTGGGCTGAGAACCCTTCTGG - Intronic
1006214653 6:32430036-32430058 TCTTGGACTTCCCAGCCTCCAGG - Intergenic
1006665218 6:35688670-35688692 TCCTGGGCTGCGAAGCCGCGTGG + Intronic
1007295935 6:40820483-40820505 TGTTGGGCTTCTCAGCCTCCAGG + Intergenic
1007305914 6:40904390-40904412 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
1010471567 6:76234220-76234242 TCTTGGACTTCCCAGCCTCCGGG + Intergenic
1011621351 6:89245765-89245787 TCTTGGACTCCCCAGCCTCCAGG + Intergenic
1012089749 6:94876079-94876101 TCTTGAGCTTAGAAGCCTACTGG - Intergenic
1012475980 6:99614654-99614676 TCTTGGGATCCCCAGGCTCCGGG - Exonic
1015763454 6:136689751-136689773 TCTTGGACTTCCCAGCCTCCAGG + Intronic
1016387384 6:143541924-143541946 GCTGGGGCTCAGAAGCCTCTTGG - Intronic
1019017819 6:168892507-168892529 TCTTGGGCTGCCCCGCCTCCTGG - Intergenic
1021582222 7:22168385-22168407 TCTTGGACTCCCCAGCCTCCAGG + Intronic
1023401858 7:39796776-39796798 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1024075838 7:45817418-45817440 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1024647760 7:51383886-51383908 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1025051599 7:55738373-55738395 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1025128562 7:56364040-56364062 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1026817995 7:73527092-73527114 TCTTGAGCTCCACAGCCTCAGGG + Intergenic
1028478202 7:91274735-91274757 TCTTGGACTTCTCAGCCTCCAGG - Intergenic
1029103203 7:98151735-98151757 TCTTGGACTTCCCAGCCTCCAGG - Intronic
1029611367 7:101628201-101628223 TCTTGGCCTCCGAAAGCTCTGGG - Intronic
1034052380 7:147997101-147997123 TCTTGGACTTCCCAGCCTCCAGG + Intronic
1034930174 7:155155208-155155230 TCTTGGGCTTCACAGCCTCCAGG + Intergenic
1037922630 8:22818241-22818263 TCTTGTGCTCTGTTGCCTCCTGG - Intronic
1038734069 8:30153351-30153373 TCTTGGACTCCCCAGCCTCTAGG + Intronic
1039385008 8:37127882-37127904 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
1041749149 8:61239938-61239960 TCTATGGCTCTGCAGCCTCCTGG - Intronic
1045546637 8:103135013-103135035 TCTTGGACTTCCCAGCCTCCAGG + Intronic
1048292605 8:133192063-133192085 TCTGGGGCTCAGAAGCTGCCAGG - Intronic
1048514262 8:135091462-135091484 TCCTGGGCTCAAAAGCCTCCTGG - Intergenic
1050953521 9:11627171-11627193 TATTTGCCTCCCAAGCCTCCGGG - Intergenic
1051003918 9:12318686-12318708 TCTTGGTCTCCAAAACCTCATGG - Intergenic
1051344669 9:16141176-16141198 GCTTGGCCTGCCAAGCCTCCTGG - Intergenic
1053755134 9:41299026-41299048 TCATGGTCTCTGAAGGCTCCAGG - Intergenic
1054331113 9:63756669-63756691 TCATGGTCTCTGAAGACTCCAGG + Intergenic
1055592281 9:77829609-77829631 TCTTGGGCTCTCAAGGCTGCGGG - Intronic
1057135030 9:92681611-92681633 TCTTGGACTCTCTAGCCTCCAGG - Intergenic
1057245461 9:93451476-93451498 GCTCCGGCTCAGAAGCCTCCCGG + Intronic
1057869501 9:98707915-98707937 CCTTGGGTTCCGGAGCCTTCCGG + Intronic
1062755103 9:138282758-138282780 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1202798489 9_KI270719v1_random:149589-149611 TCATGGTCTCTGAAGGCTCCAGG + Intergenic
1203579011 Un_KI270745v1:26927-26949 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1186100871 X:6155234-6155256 TCTTGTTCTCAGAAACCTCCTGG - Intronic
1186451771 X:9679980-9680002 TCTTGGACTTCCCAGCCTCCAGG - Intronic
1188351805 X:29140687-29140709 TCTTGGACTTCTCAGCCTCCAGG - Intronic
1191695366 X:63985017-63985039 TCCTGGCCCCCGAAGACTCCAGG + Intergenic
1192146509 X:68686396-68686418 TCTTGGGCTGCTTAGCCGCCTGG + Intronic
1195295382 X:103471498-103471520 TCATGTGTTCTGAAGCCTCCAGG - Intergenic
1196666079 X:118318175-118318197 TCTTGGACTTCCCAGCCTCCAGG + Intergenic
1197412063 X:126128914-126128936 TTTTGGACTCCACAGCCTCCAGG + Intergenic
1198778261 X:140204915-140204937 TCTTGAGCTTCCAAGCCTGCAGG + Intergenic
1202381631 Y:24279545-24279567 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1202489154 Y:25390581-25390603 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic