ID: 1074068151

View in Genome Browser
Species Human (GRCh38)
Location 10:110037519-110037541
Sequence CACTTGAATCTAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074068145_1074068151 9 Left 1074068145 10:110037487-110037509 CCCAGCTGCTTGGAAAGCTGAGG 0: 12
1: 568
2: 12989
3: 122270
4: 238866
Right 1074068151 10:110037519-110037541 CACTTGAATCTAGGAGACGGAGG No data
1074068144_1074068151 17 Left 1074068144 10:110037479-110037501 CCTGTAGTCCCAGCTGCTTGGAA 0: 62
1: 3527
2: 55058
3: 173234
4: 254158
Right 1074068151 10:110037519-110037541 CACTTGAATCTAGGAGACGGAGG No data
1074068147_1074068151 8 Left 1074068147 10:110037488-110037510 CCAGCTGCTTGGAAAGCTGAGGC 0: 8
1: 418
2: 10318
3: 107167
4: 221893
Right 1074068151 10:110037519-110037541 CACTTGAATCTAGGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074068151 Original CRISPR CACTTGAATCTAGGAGACGG AGG Intronic
No off target data available for this crispr