ID: 1074068421

View in Genome Browser
Species Human (GRCh38)
Location 10:110040402-110040424
Sequence CACACAGCACAAATTTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074068418_1074068421 14 Left 1074068418 10:110040365-110040387 CCTGAAACATGATTGAACAGATT 0: 1
1: 0
2: 0
3: 11
4: 219
Right 1074068421 10:110040402-110040424 CACACAGCACAAATTTAGTTTGG No data
1074068417_1074068421 22 Left 1074068417 10:110040357-110040379 CCAGCTTACCTGAAACATGATTG 0: 1
1: 0
2: 2
3: 9
4: 123
Right 1074068421 10:110040402-110040424 CACACAGCACAAATTTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074068421 Original CRISPR CACACAGCACAAATTTAGTT TGG Intronic
No off target data available for this crispr