ID: 1074069660

View in Genome Browser
Species Human (GRCh38)
Location 10:110053641-110053663
Sequence GTGAAAATTAAGACTACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074069660_1074069661 11 Left 1074069660 10:110053641-110053663 CCATCAGTAGTCTTAATTTTCAC 0: 1
1: 0
2: 0
3: 21
4: 211
Right 1074069661 10:110053675-110053697 TGACTGATTCATTTTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074069660 Original CRISPR GTGAAAATTAAGACTACTGA TGG (reversed) Intronic
902720309 1:18299920-18299942 GGGAAATTTAAGGCTGCTGAAGG - Intronic
904502499 1:30923701-30923723 GGTAAAATTAAGATTACTAAGGG - Intergenic
905729881 1:40290084-40290106 GTGAAACTAAAAACTACTGGCGG + Intronic
909931029 1:81500713-81500735 GTGAAAATGGATACTAGTGATGG + Intronic
911340953 1:96635523-96635545 GTGAATTTTAAGATAACTGAAGG - Intergenic
911717874 1:101155545-101155567 GTGAAAATAAAAAACACTGAAGG + Intergenic
912000531 1:104828804-104828826 ATGAAAATTAATAATATTGATGG - Intergenic
912310811 1:108619322-108619344 GAGAAAAGAAAAACTACTGAGGG - Intronic
913484791 1:119324316-119324338 GTGAAAATGAAGCCTTCTTAAGG - Intergenic
913536447 1:119777555-119777577 TTGAAAAATAAGAATAATGAGGG + Intergenic
913561116 1:120020939-120020961 GTGAAAATAAAGACTAAGAAAGG - Intronic
913637011 1:120772663-120772685 GTGAAAATAAAGACTAAGAAAGG + Intergenic
914542744 1:148631287-148631309 GTGAAAATAAAGACTAAGAAAGG - Intronic
914623890 1:149439956-149439978 GTGAAAATAAAGACTAAGAAAGG + Intergenic
915465594 1:156096103-156096125 GAGAAAATCAAGACTTCAGAGGG - Intronic
915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG + Intergenic
918101563 1:181380673-181380695 GCTAAAATTAAAAATACTGATGG + Intergenic
918559457 1:185847089-185847111 GTGAAAAATAAGAAATCTGATGG - Intronic
919150045 1:193684839-193684861 GTGAAAAGTGAGACATCTGAGGG + Intergenic
919168385 1:193924314-193924336 ATGAAAATTATGACTTCTGTAGG + Intergenic
919324814 1:196093683-196093705 GTCAAAATTAAGATTACAAATGG + Intergenic
920769069 1:208863434-208863456 GTGTAAATAGAGACTAATGATGG + Intergenic
922147743 1:222964999-222965021 TTGAAAAAAAAAACTACTGAAGG - Intronic
923700420 1:236294847-236294869 GTGAAGACTGTGACTACTGATGG - Intergenic
924367150 1:243307021-243307043 CTGAAAAATGAGACTACTGAAGG - Intronic
924861357 1:247926055-247926077 GTGAAAATCAAGCCTACTACAGG - Intergenic
1064188355 10:13183557-13183579 GTGGAAATTCAGAATACTGATGG - Intronic
1064952395 10:20867965-20867987 ATGAAAATGAAGACCAGTGAAGG - Intronic
1066112662 10:32211010-32211032 CAGAAAATTAAGACTATTAAAGG + Intergenic
1067954902 10:50780367-50780389 GTGAAAATTGAGGCTGCTGCTGG - Intronic
1067988774 10:51184586-51184608 GTGAAACTAATGACTAATGAAGG + Intronic
1068001478 10:51339065-51339087 GCAAAATTTAAGACTACTTATGG - Intronic
1068412029 10:56668714-56668736 GTAAAAATTAAGTCTGCAGATGG + Intergenic
1071389253 10:85154412-85154434 CTGAAAATTAGGATTACTAAGGG + Intergenic
1071704634 10:87983741-87983763 GGAAAAAGTAAGACTACTGTGGG - Intergenic
1073744540 10:106450890-106450912 TTGAAAAGTAAGATTAGTGAGGG + Intergenic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074548631 10:114422657-114422679 TTGAAAATTAAGACAAATTAGGG + Intergenic
1074846245 10:117401009-117401031 GTTAAAATCAAGACAAGTGATGG - Intergenic
1076703310 10:132285273-132285295 GTGAGAATATAGACTCCTGAGGG - Intronic
1077449649 11:2631216-2631238 GTGAACATTAACTCTCCTGATGG + Intronic
1078314122 11:10278042-10278064 GGGAAAATTAATACTATTGCAGG - Intronic
1082138662 11:48580410-48580432 GTGAAATTTCAGACTTCTAAGGG + Intergenic
1083393222 11:62370917-62370939 GTGATAAGTAAGTCTACTGGTGG + Intronic
1084135013 11:67171666-67171688 GTGAGAATTAAGACGAATGATGG - Intronic
1085206120 11:74732876-74732898 GTTAAAATAAAGAATACTCAGGG - Intergenic
1085217956 11:74848831-74848853 CTGAAGAATGAGACTACTGAGGG - Intronic
1085539151 11:77250249-77250271 TAGAAAATTGGGACTACTGAAGG - Intronic
1086543058 11:87935425-87935447 GTGAAAAAGAAGTCTTCTGAAGG - Intergenic
1087902957 11:103663370-103663392 GTTAAAATTGAGACTGCTCAGGG - Intergenic
1088689365 11:112311932-112311954 GTGAAAATTAGGTTTACTTATGG - Intergenic
1092936998 12:13373497-13373519 GGGAAAATCAAGAATACTAAGGG + Intronic
1093170955 12:15859705-15859727 AAGAAAATTAAGACTCATGATGG - Intronic
1093507413 12:19884720-19884742 GTCAGAATAAAGACAACTGAGGG + Intergenic
1094035070 12:26060991-26061013 GTTAAAATGAAGACTCCAGAGGG + Intronic
1094412348 12:30179921-30179943 GAGAAAATTAATTCTACCGATGG + Intergenic
1094798745 12:34005108-34005130 ATGAAAATTAAGAACAATGAAGG + Intergenic
1095693097 12:45113128-45113150 ATGAAAATGAAGAGAACTGAAGG + Intergenic
1096860121 12:54520330-54520352 ATGTGAATTAACACTACTGAAGG + Intronic
1097168647 12:57099616-57099638 GTGAACATTTAGACCACAGAAGG + Intronic
1098420086 12:70286265-70286287 ATGAATATGAGGACTACTGATGG - Intronic
1099976848 12:89554984-89555006 GTGAAAATAAAAGCTACAGATGG + Intergenic
1100064740 12:90628469-90628491 GAGAAAATTAATGATACTGAAGG - Intergenic
1106195333 13:27488810-27488832 GTTAAAATTAAGAGTATTTAGGG + Intergenic
1107622823 13:42250989-42251011 TTTAAAATTAAGATTACTGCAGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109947328 13:69453877-69453899 GTGAAAAGCAAGACTAGGGAGGG - Intergenic
1110621086 13:77596521-77596543 GGGAAAATTAAGTCCACAGAAGG + Intronic
1112904784 13:104403661-104403683 TTAAAAATGAAGACTAATGAAGG + Intergenic
1116299248 14:43156115-43156137 GTGAGAATGAAGACTAGGGAAGG - Intergenic
1116587360 14:46724578-46724600 GTGAAAATTAAGAGTTCTTGAGG + Intergenic
1119074587 14:71623343-71623365 TTGGAAATTAAGACTACTTTAGG + Intronic
1120470269 14:84914634-84914656 GTGAAAATTAAGATCACTAAGGG - Intergenic
1120655060 14:87179522-87179544 GGGAAAACTGAGACTACAGAGGG - Intergenic
1122335227 14:100971130-100971152 GTGAAAATTGAGACCAATGATGG + Intergenic
1125219019 15:37311623-37311645 GGGAAAATTAATACCACTGGAGG + Intergenic
1125493420 15:40166634-40166656 ATGAAAATTATGTCTACTGCTGG - Intronic
1126310364 15:47309157-47309179 GTGAAAAGCAAAACCACTGATGG - Intronic
1129712598 15:77828155-77828177 GTGCAAAGTCAAACTACTGAGGG - Intergenic
1131947125 15:97635826-97635848 GTTAAAATTAGATCTACTGATGG + Intergenic
1133370724 16:5243755-5243777 TGGAAAATTAATACTACTGCAGG + Intergenic
1133463770 16:6010091-6010113 GGGGACATTAAGAATACTGAGGG + Intergenic
1134210651 16:12273656-12273678 GTGAATATAAAAACCACTGAGGG - Intronic
1134883032 16:17763447-17763469 GTGAAAATCAAGACTATCTAGGG + Intergenic
1135141566 16:19926518-19926540 GGGAGAATTAAGAATACAGATGG - Intergenic
1137738855 16:50745256-50745278 GGGAACAGTAAGACAACTGAAGG - Intronic
1138963329 16:62053285-62053307 GTTAAAAGTAAGATTTCTGAAGG - Intergenic
1139094315 16:63686019-63686041 GTGAATATTAAGTCTATTAATGG - Intergenic
1141968192 16:87461308-87461330 GTGAAATTTTAAAATACTGATGG - Intronic
1148002899 17:44400401-44400423 GTGAAAATTAATAGTTCTGATGG + Exonic
1152524877 17:80882746-80882768 GTAAAAATGAAGAATACTCATGG + Intronic
1153317824 18:3741667-3741689 GTGAGAATTAATGTTACTGATGG - Intronic
1153475727 18:5496508-5496530 TTGCAAATTAAGTCTATTGAGGG + Intronic
1155448635 18:25940667-25940689 CTGAAAATTAAGGCTACTTAGGG - Intergenic
1156120878 18:33841434-33841456 GTTAAAATTTAGACGCCTGAGGG - Intergenic
1156794638 18:41028815-41028837 ATTAAAATTAAAAATACTGATGG + Intergenic
1157033631 18:43944084-43944106 GTGAATATTAAGATTCCTGCTGG - Intergenic
1158151579 18:54379136-54379158 GACAAACTTAAGACTACAGATGG - Exonic
1161725903 19:5928652-5928674 GAGAGAATTCAAACTACTGACGG + Intronic
1163532079 19:17855878-17855900 GTGAAAATTCGGAAAACTGATGG - Intergenic
928661082 2:33502371-33502393 GAGCAAATTAAGACAAATGAAGG - Intronic
929317945 2:40503204-40503226 GGGAAAATTAAGACAAATTATGG - Intronic
931589261 2:63863753-63863775 GTAATAACTAAGAGTACTGATGG + Intronic
931675405 2:64690198-64690220 GTGAAAATTCATACTTCAGAAGG + Intronic
934892909 2:98086662-98086684 GTGAAAATTAAAACTACACAGGG + Intergenic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
937531342 2:122830967-122830989 ATGAAAAATAAGAGTAATGAGGG - Intergenic
940990506 2:160091830-160091852 GCCAAAAATAAGAGTACTGATGG - Intergenic
941263383 2:163325966-163325988 GTAAAAATTATCACTACTGTAGG - Intergenic
941473072 2:165914120-165914142 CTGAAAATGTAGACTACTAAAGG + Intronic
942311800 2:174663384-174663406 GTTAAAATGAAGACTATTAATGG - Intronic
942354419 2:175093897-175093919 ATGAAAATTAAGGCTCCTGTGGG - Intronic
942409918 2:175698167-175698189 GTGTAAATTCACACTACTGAAGG + Intergenic
943342552 2:186697970-186697992 GTGAAAATAAAGACTAAGGTTGG + Intronic
945512426 2:210719222-210719244 GTGAAAATTATGATTAATAATGG + Intergenic
945518751 2:210796890-210796912 GTGAAGATAAATACTACAGAAGG - Intergenic
946469847 2:219948526-219948548 GTACAAATTAAGATTACAGAAGG + Intergenic
946587030 2:221201222-221201244 GAGAAAATTGAGAATGCTGAAGG + Intergenic
948428975 2:237906548-237906570 GTGAAAATGAAGACAATAGAAGG - Intronic
948766124 2:240220403-240220425 ATGAAAATTTAGACAACTGGTGG - Intergenic
1173707388 20:45122123-45122145 TTGAAAATGTAGACTAATGAAGG - Intergenic
1173927649 20:46792659-46792681 GTGAAAATTTAGATGTCTGAGGG - Intergenic
1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG + Intronic
1175015908 20:55790391-55790413 GTGGAAATGAAGCCAACTGAGGG - Intergenic
1177046524 21:16177260-16177282 GTAAAATTAAAGAATACTGAAGG - Intergenic
1177058115 21:16334885-16334907 GTCAAAATAAAGGCTGCTGAAGG - Intergenic
1177802169 21:25838804-25838826 GTGAGAATTAAGATTACAGATGG - Intergenic
1178522073 21:33294793-33294815 GTGAAGATTAAGAGCACTGGTGG + Intronic
1179402610 21:41097965-41097987 GTAAAATTTAAGACTTTTGAGGG - Intergenic
1183963937 22:41429944-41429966 GTGAAAATTAAAAGAAATGATGG - Intergenic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
950928612 3:16767351-16767373 GTGAAAATTAAAATTAAGGAAGG + Intergenic
951868370 3:27333196-27333218 GTGATAATGTGGACTACTGAGGG - Intronic
955966520 3:64394584-64394606 GTGAAAATTAAGAGGAATAACGG - Intronic
956144270 3:66176570-66176592 CTAAAAATTGAGACTATTGAGGG + Intronic
957838069 3:85625654-85625676 GTGAAAATGAAGACAATTTAGGG + Intronic
957932888 3:86905003-86905025 ATGAAAAGTATGACTACAGAGGG + Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
960273771 3:115703073-115703095 GTCAAAATAAAGAGTACTTAAGG + Intronic
961240882 3:125410302-125410324 CTGAAAATGCAGACTACTGCAGG + Intergenic
961391428 3:126554608-126554630 GTGAGCATTGAGACTACTGGAGG + Intronic
961433656 3:126901327-126901349 GTGAAACTTAGGACGACTGCTGG - Intronic
963703742 3:148659538-148659560 GAGAAAATTAAGAATTATGAAGG - Intergenic
965455911 3:168900423-168900445 TTGAAAATTTAGAGTACTCAAGG + Intergenic
965690783 3:171354675-171354697 ATGTAGATTAAGACTGCTGAGGG + Intronic
966648446 3:182272293-182272315 GTGAATATTAATACTGATGATGG + Intergenic
967508503 3:190281973-190281995 GTGAAAATTCAGAATTCTGAAGG + Intergenic
967706661 3:192659153-192659175 CAGAAAATTATAACTACTGAGGG + Intronic
968151526 3:196340503-196340525 GTGTAAATTAGGACTACTTTGGG - Intergenic
970225718 4:13854991-13855013 GGTAAAATTCAGAGTACTGATGG - Intergenic
970570814 4:17380676-17380698 GTCAAAATTAATGCTAATGACGG + Intergenic
970865276 4:20751069-20751091 GTAGTAATTAACACTACTGAAGG + Intronic
971929312 4:33059361-33059383 GAGTAAATTAAGAGCACTGAAGG + Intergenic
976092541 4:81472883-81472905 GTTATAATTAAGATTACTGAGGG + Intronic
976675907 4:87703221-87703243 TTGAAATTTAGGACTACTGAAGG - Intergenic
977351942 4:95899391-95899413 GTGAAAATTAACATTTCTAAGGG - Intergenic
977548126 4:98409842-98409864 GTGAAAGTTAAAACTTCAGAGGG + Intronic
979094522 4:116529780-116529802 ATGTAATTTAGGACTACTGAAGG + Intergenic
979121817 4:116912479-116912501 TTGAAAATTAAGATAACTGTAGG + Intergenic
979479551 4:121200364-121200386 GTCTAAATAAAGTCTACTGAGGG - Intronic
979835084 4:125356944-125356966 GTAAAAATTAAGTCCCCTGAGGG + Intronic
979970921 4:127134261-127134283 AAGAATATTAAGACTACTTAAGG - Intergenic
981242737 4:142497717-142497739 GAGAAAATTAGGACTACTACTGG - Intronic
981802327 4:148672811-148672833 GTAAAAATTAAGGCTACCGGCGG - Intergenic
982149837 4:152441305-152441327 GAGAAAATCAAAGCTACTGATGG - Intronic
982946286 4:161628794-161628816 GTCAAGATTCAGACTACTAATGG + Intronic
983295642 4:165864910-165864932 TTGAAAATTAAGATTACCAAAGG - Intergenic
984119403 4:175723684-175723706 TTGAAAATTAAGAGTAATAAGGG + Intronic
984580748 4:181507212-181507234 GTGAAAATAAATACTTCTGTGGG - Intergenic
987752064 5:22053034-22053056 TTTAAATTTAAGAATACTGAGGG + Intronic
989684444 5:44068801-44068823 GTCAAAACAAAGACTACTCAGGG + Intergenic
990250553 5:53910088-53910110 GTGAAAGTTAAGAATCCTGAGGG - Intronic
991018154 5:61953238-61953260 GTGTAAATTAAGACTATTCCAGG + Intergenic
991314393 5:65283818-65283840 GTAAAAATTAAGACAACTGTGGG + Intronic
993112263 5:83672559-83672581 GTGAAAAGTATGACTTGTGAAGG - Intronic
993580801 5:89658927-89658949 GTCAAAAATAAGGCTACTGTAGG - Intergenic
994977805 5:106832363-106832385 GAGAAAATTCAGACCACAGAGGG + Intergenic
998964443 5:147524068-147524090 GTCATAATTAAGAAAACTGAGGG + Intergenic
999480567 5:151944405-151944427 ATGAAAATTAGGACTATAGAAGG - Intergenic
999788619 5:154915473-154915495 GTGAAATTTAAGATTTCTTATGG + Intronic
1000982108 5:167827081-167827103 ATGAAACTGAAGACTACTTAGGG - Intronic
1003199350 6:3944734-3944756 CTGAAAATCAAAAGTACTGATGG - Intergenic
1007205902 6:40150584-40150606 GTAAAGAATAAGAATACTGAAGG - Intergenic
1007867297 6:44986533-44986555 GTAAAGATTTCGACTACTGATGG - Intronic
1007944930 6:45817640-45817662 GAGAAAAAGAAGACTACTGGGGG - Intergenic
1008502931 6:52201322-52201344 GTGAAATTTCAGAATACTGAAGG + Intergenic
1009716104 6:67398158-67398180 GAGATAATTAAGGCTAATGAAGG + Intergenic
1010567415 6:77432585-77432607 GGGAAAGTTAAGCCTACAGATGG + Intergenic
1011094772 6:83648629-83648651 ACTAAAATTAAAACTACTGATGG - Intronic
1011361558 6:86530761-86530783 GTGATAATTATTACTACTCATGG + Intergenic
1011586072 6:88926718-88926740 GGAAAAGTTAAGACTGCTGAAGG - Intronic
1012551528 6:100467898-100467920 GGCAAAATCAAGACTACAGAAGG + Intergenic
1012969303 6:105710410-105710432 GTAAAAATTCTGACTACTTAAGG + Intergenic
1015020900 6:128473354-128473376 GTCAAAATTAATATCACTGAGGG - Intronic
1016167185 6:140960985-140961007 GTGAAAATATAGAATACAGAAGG + Intergenic
1016884546 6:148947066-148947088 GTGTAAATTAAGAATAATGTGGG + Intronic
1017612754 6:156208342-156208364 TAGAAAATGAATACTACTGAGGG + Intergenic
1020582481 7:10021484-10021506 GAAAAAAATAAGGCTACTGATGG + Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021917395 7:25448660-25448682 GGGAAAATTAAGACTACGTATGG - Intergenic
1022784210 7:33621096-33621118 GTGAAACTGCAGACTACTAATGG + Intergenic
1024413106 7:49070313-49070335 GAGACAATTACTACTACTGAGGG - Intergenic
1027294882 7:76759701-76759723 GTGAAATTTCAGAGTGCTGAAGG + Intergenic
1028708532 7:93879984-93880006 ATGAAAAGTAAGCCTACAGATGG + Intronic
1030284919 7:107816074-107816096 GAGAAACTTAAGATTACAGAAGG - Intergenic
1032596170 7:133243026-133243048 GGGAAAATTAAAAATACTCATGG - Intergenic
1033485276 7:141783103-141783125 GTGAAACTGAAGCTTACTGAAGG + Intronic
1038690294 8:29755193-29755215 GGGAAAATTAAGAATGATGACGG + Intergenic
1040440207 8:47433543-47433565 GGGAAAGCTAAGACTACTAATGG + Intronic
1040601474 8:48888816-48888838 GTTAAAATTAAAATTACTGCAGG - Intergenic
1041346885 8:56908780-56908802 TAGAAAATTAAGACTAATAAAGG + Intergenic
1042858313 8:73289293-73289315 GTCAGAATTAAGACTAATTATGG - Intergenic
1043023650 8:75038765-75038787 GTGAAAGATAAGACAATTGATGG - Intergenic
1043221622 8:77673099-77673121 TTTAAAGTTAACACTACTGAAGG + Intergenic
1043779264 8:84311717-84311739 CTGAAAATGAAGAGTAATGAAGG + Intronic
1046923243 8:119757236-119757258 GTGTAAAATAAGACTACGGAAGG + Intronic
1047378116 8:124324138-124324160 TTGAAAATTAAGTCTTCTAATGG - Intronic
1050229747 9:3509560-3509582 CTTAAAATAAAGCCTACTGATGG + Intronic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1052314899 9:27106204-27106226 GTAAAAATGAAGAAGACTGAGGG - Intergenic
1055278855 9:74650985-74651007 GTGAAAATCAATCCTAGTGATGG + Intronic
1055326425 9:75135548-75135570 GGAAAAATTAAGAAAACTGAAGG - Intronic
1055404432 9:75959702-75959724 GTGAAACTTAAGAATCCTTATGG + Intronic
1058168702 9:101652125-101652147 ATGAAAATTATGACTCCTCATGG - Intronic
1059143843 9:111879303-111879325 GTAAATACTAAGACTAATGATGG + Intergenic
1059617102 9:115962956-115962978 ATAAAAATCAAGACAACTGATGG - Intergenic
1060849532 9:126862312-126862334 GTCAAAGTTGAAACTACTGAAGG + Intronic
1061010142 9:127949899-127949921 GTGAAAATGATGGCTGCTGAGGG - Intronic
1187451314 X:19399133-19399155 ATGACAATTAAGATTACTAAAGG + Intronic
1188487004 X:30692936-30692958 GTGATAAATAAGAATACAGATGG + Intronic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1191876065 X:65797746-65797768 GTAAAAATTAAAACTACAAAAGG - Intergenic
1193762336 X:85482917-85482939 TTGAAAATAGATACTACTGATGG - Intergenic