ID: 1074071051

View in Genome Browser
Species Human (GRCh38)
Location 10:110069723-110069745
Sequence GTGTCAGATTACAATTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074071050_1074071051 -3 Left 1074071050 10:110069703-110069725 CCTCTTTTCATGGTGATGTGGTG 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1074071051 10:110069723-110069745 GTGTCAGATTACAATTTGACTGG No data
1074071046_1074071051 26 Left 1074071046 10:110069674-110069696 CCTTAGTATTAACCTAGAACATT 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1074071051 10:110069723-110069745 GTGTCAGATTACAATTTGACTGG No data
1074071047_1074071051 14 Left 1074071047 10:110069686-110069708 CCTAGAACATTCTTATGCCTCTT 0: 1
1: 0
2: 1
3: 24
4: 265
Right 1074071051 10:110069723-110069745 GTGTCAGATTACAATTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074071051 Original CRISPR GTGTCAGATTACAATTTGAC TGG Intronic
No off target data available for this crispr