ID: 1074073542

View in Genome Browser
Species Human (GRCh38)
Location 10:110098749-110098771
Sequence TGTAATCACAGCTACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710149
Summary {0: 404, 1: 49382, 2: 218969, 3: 256696, 4: 184698}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074073542_1074073552 27 Left 1074073542 10:110098749-110098771 CCTCCCGAGTAGCTGTGATTACA 0: 404
1: 49382
2: 218969
3: 256696
4: 184698
Right 1074073552 10:110098799-110098821 TTTTGTATTTTCAGTAAAGGCGG 0: 6
1: 542
2: 17688
3: 216204
4: 130212
1074073542_1074073554 29 Left 1074073542 10:110098749-110098771 CCTCCCGAGTAGCTGTGATTACA 0: 404
1: 49382
2: 218969
3: 256696
4: 184698
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073542_1074073553 28 Left 1074073542 10:110098749-110098771 CCTCCCGAGTAGCTGTGATTACA 0: 404
1: 49382
2: 218969
3: 256696
4: 184698
Right 1074073553 10:110098800-110098822 TTTGTATTTTCAGTAAAGGCGGG 0: 4
1: 490
2: 15842
3: 190428
4: 208819
1074073542_1074073551 24 Left 1074073542 10:110098749-110098771 CCTCCCGAGTAGCTGTGATTACA 0: 404
1: 49382
2: 218969
3: 256696
4: 184698
Right 1074073551 10:110098796-110098818 ATTTTTTGTATTTTCAGTAAAGG 0: 3
1: 108
2: 2179
3: 7600
4: 6919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074073542 Original CRISPR TGTAATCACAGCTACTCGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr