ID: 1074073544

View in Genome Browser
Species Human (GRCh38)
Location 10:110098752-110098774
Sequence GCCTGTAATCACAGCTACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699332
Summary {0: 693, 1: 79489, 2: 214602, 3: 231381, 4: 173167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074073544_1074073554 26 Left 1074073544 10:110098752-110098774 CCCGAGTAGCTGTGATTACAGGC 0: 693
1: 79489
2: 214602
3: 231381
4: 173167
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073544_1074073551 21 Left 1074073544 10:110098752-110098774 CCCGAGTAGCTGTGATTACAGGC 0: 693
1: 79489
2: 214602
3: 231381
4: 173167
Right 1074073551 10:110098796-110098818 ATTTTTTGTATTTTCAGTAAAGG 0: 3
1: 108
2: 2179
3: 7600
4: 6919
1074073544_1074073553 25 Left 1074073544 10:110098752-110098774 CCCGAGTAGCTGTGATTACAGGC 0: 693
1: 79489
2: 214602
3: 231381
4: 173167
Right 1074073553 10:110098800-110098822 TTTGTATTTTCAGTAAAGGCGGG 0: 4
1: 490
2: 15842
3: 190428
4: 208819
1074073544_1074073552 24 Left 1074073544 10:110098752-110098774 CCCGAGTAGCTGTGATTACAGGC 0: 693
1: 79489
2: 214602
3: 231381
4: 173167
Right 1074073552 10:110098799-110098821 TTTTGTATTTTCAGTAAAGGCGG 0: 6
1: 542
2: 17688
3: 216204
4: 130212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074073544 Original CRISPR GCCTGTAATCACAGCTACTC GGG (reversed) Intronic
Too many off-targets to display for this crispr