ID: 1074073545

View in Genome Browser
Species Human (GRCh38)
Location 10:110098753-110098775
Sequence TGCCTGTAATCACAGCTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558415
Summary {0: 522, 1: 57111, 2: 105870, 3: 158095, 4: 236817}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074073545_1074073552 23 Left 1074073545 10:110098753-110098775 CCGAGTAGCTGTGATTACAGGCA 0: 522
1: 57111
2: 105870
3: 158095
4: 236817
Right 1074073552 10:110098799-110098821 TTTTGTATTTTCAGTAAAGGCGG 0: 6
1: 542
2: 17688
3: 216204
4: 130212
1074073545_1074073554 25 Left 1074073545 10:110098753-110098775 CCGAGTAGCTGTGATTACAGGCA 0: 522
1: 57111
2: 105870
3: 158095
4: 236817
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073545_1074073551 20 Left 1074073545 10:110098753-110098775 CCGAGTAGCTGTGATTACAGGCA 0: 522
1: 57111
2: 105870
3: 158095
4: 236817
Right 1074073551 10:110098796-110098818 ATTTTTTGTATTTTCAGTAAAGG 0: 3
1: 108
2: 2179
3: 7600
4: 6919
1074073545_1074073553 24 Left 1074073545 10:110098753-110098775 CCGAGTAGCTGTGATTACAGGCA 0: 522
1: 57111
2: 105870
3: 158095
4: 236817
Right 1074073553 10:110098800-110098822 TTTGTATTTTCAGTAAAGGCGGG 0: 4
1: 490
2: 15842
3: 190428
4: 208819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074073545 Original CRISPR TGCCTGTAATCACAGCTACT CGG (reversed) Intronic
Too many off-targets to display for this crispr