ID: 1074073546

View in Genome Browser
Species Human (GRCh38)
Location 10:110098776-110098798
Sequence AATTAGTTGGGCGTGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179965
Summary {0: 137, 1: 4885, 2: 27615, 3: 64004, 4: 83324}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074073546_1074073556 21 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073556 10:110098820-110098842 GGGGTTTCACTATGTTGGCCAGG 0: 5858
1: 78435
2: 176064
3: 221734
4: 188168
1074073546_1074073557 25 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073557 10:110098824-110098846 TTTCACTATGTTGGCCAGGCTGG 0: 8963
1: 103499
2: 178183
3: 237474
4: 253532
1074073546_1074073552 0 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073552 10:110098799-110098821 TTTTGTATTTTCAGTAAAGGCGG 0: 6
1: 542
2: 17688
3: 216204
4: 130212
1074073546_1074073551 -3 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073551 10:110098796-110098818 ATTTTTTGTATTTTCAGTAAAGG 0: 3
1: 108
2: 2179
3: 7600
4: 6919
1074073546_1074073554 2 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073546_1074073555 16 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073555 10:110098815-110098837 AAGGCGGGGTTTCACTATGTTGG No data
1074073546_1074073553 1 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073553 10:110098800-110098822 TTTGTATTTTCAGTAAAGGCGGG 0: 4
1: 490
2: 15842
3: 190428
4: 208819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074073546 Original CRISPR AATTAGTTGGGCGTGGTGGT AGG (reversed) Intronic
Too many off-targets to display for this crispr