ID: 1074073549

View in Genome Browser
Species Human (GRCh38)
Location 10:110098788-110098810
Sequence GAAAATACAAAAAATTAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145900
Summary {0: 15, 1: 1150, 2: 24761, 3: 73712, 4: 46262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074073549_1074073554 -10 Left 1074073549 10:110098788-110098810 CCCAACTAATTTTTTGTATTTTC 0: 15
1: 1150
2: 24761
3: 73712
4: 46262
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073549_1074073556 9 Left 1074073549 10:110098788-110098810 CCCAACTAATTTTTTGTATTTTC 0: 15
1: 1150
2: 24761
3: 73712
4: 46262
Right 1074073556 10:110098820-110098842 GGGGTTTCACTATGTTGGCCAGG 0: 5858
1: 78435
2: 176064
3: 221734
4: 188168
1074073549_1074073555 4 Left 1074073549 10:110098788-110098810 CCCAACTAATTTTTTGTATTTTC 0: 15
1: 1150
2: 24761
3: 73712
4: 46262
Right 1074073555 10:110098815-110098837 AAGGCGGGGTTTCACTATGTTGG No data
1074073549_1074073557 13 Left 1074073549 10:110098788-110098810 CCCAACTAATTTTTTGTATTTTC 0: 15
1: 1150
2: 24761
3: 73712
4: 46262
Right 1074073557 10:110098824-110098846 TTTCACTATGTTGGCCAGGCTGG 0: 8963
1: 103499
2: 178183
3: 237474
4: 253532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074073549 Original CRISPR GAAAATACAAAAAATTAGTT GGG (reversed) Intronic
Too many off-targets to display for this crispr