ID: 1074073554

View in Genome Browser
Species Human (GRCh38)
Location 10:110098801-110098823
Sequence TTGTATTTTCAGTAAAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074073542_1074073554 29 Left 1074073542 10:110098749-110098771 CCTCCCGAGTAGCTGTGATTACA 0: 404
1: 49382
2: 218969
3: 256696
4: 184698
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073546_1074073554 2 Left 1074073546 10:110098776-110098798 CCTACCACCACGCCCAACTAATT 0: 137
1: 4885
2: 27615
3: 64004
4: 83324
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073548_1074073554 -5 Left 1074073548 10:110098783-110098805 CCACGCCCAACTAATTTTTTGTA 0: 187
1: 8755
2: 34498
3: 46231
4: 61532
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073544_1074073554 26 Left 1074073544 10:110098752-110098774 CCCGAGTAGCTGTGATTACAGGC 0: 693
1: 79489
2: 214602
3: 231381
4: 173167
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073545_1074073554 25 Left 1074073545 10:110098753-110098775 CCGAGTAGCTGTGATTACAGGCA 0: 522
1: 57111
2: 105870
3: 158095
4: 236817
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073549_1074073554 -10 Left 1074073549 10:110098788-110098810 CCCAACTAATTTTTTGTATTTTC 0: 15
1: 1150
2: 24761
3: 73712
4: 46262
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data
1074073547_1074073554 -2 Left 1074073547 10:110098780-110098802 CCACCACGCCCAACTAATTTTTT 0: 327
1: 15581
2: 81421
3: 175401
4: 197227
Right 1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074073554 Original CRISPR TTGTATTTTCAGTAAAGGCG GGG Intronic
No off target data available for this crispr