ID: 1074075865

View in Genome Browser
Species Human (GRCh38)
Location 10:110123959-110123981
Sequence CCAAATGCTGTTATTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074075865 Original CRISPR CCAAATGCTGTTATTGATAC AGG Intronic
902935732 1:19763334-19763356 CCAAGTGCTGGGATTGTTACAGG + Intronic
903998501 1:27323320-27323342 CCACTGGCTGTTATTGATAGCGG - Intronic
904837980 1:33351046-33351068 CCAACTGCTGTTCTTGAGTCTGG - Intronic
904924426 1:34036017-34036039 CCCAATGCTGGTGATGATACAGG + Intronic
908374850 1:63524897-63524919 CCAAATATTGTTATTAATAAAGG + Intronic
908491585 1:64649673-64649695 CCAAATTCTCTTACTGATAGTGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
912485538 1:110024641-110024663 CCAAAGTCTGTTTTAGATACTGG + Intergenic
912668463 1:111604287-111604309 CTAAATGCTGTCAGTGACACAGG + Intronic
917776844 1:178346628-178346650 CCAAGTGCTGTTTTTTATAGGGG - Intronic
919760943 1:201097699-201097721 CCAAATGCTATTACTGATGGGGG - Intronic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066618526 10:37320758-37320780 CAAAGTGATCTTATTGATACAGG + Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1069531025 10:69219597-69219619 CCAAGTGCTGCGATTGTTACAGG + Intergenic
1070323835 10:75374720-75374742 CCAGATGCTGTTGTAGGTACTGG - Intergenic
1071512079 10:86268336-86268358 CCAAATGCTGTTGGTGATACCGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1074075865 10:110123959-110123981 CCAAATGCTGTTATTGATACAGG + Intronic
1081004248 11:37714487-37714509 TCACATGCTGGTGTTGATACTGG - Intergenic
1082704292 11:56474411-56474433 CCAAATACTGTTATAAATACTGG - Intergenic
1086914324 11:92511391-92511413 CCAAATGCTCTTATTCATAGGGG + Intronic
1087569909 11:99913026-99913048 CCAAGTGCTTTTATAGATATTGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1089583900 11:119497999-119498021 GCACATGCTGTTATTGAGAGCGG - Intergenic
1091069263 11:132548037-132548059 CCAAATGCTGTTTCTGCTTCAGG - Intronic
1093867478 12:24245727-24245749 CCAAATTTTGTTATTGTTGCTGG - Intergenic
1094044330 12:26150721-26150743 CCAAATGCTGTGAGTGCTAGTGG + Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095379321 12:41570681-41570703 TCAAAGAATGTTATTGATACTGG - Intronic
1098834510 12:75405840-75405862 CCAAATGGTTTTATTTATAATGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1109073354 13:57799508-57799530 ACAAATGCTGTTTTTCTTACTGG + Intergenic
1113370077 13:109716207-109716229 GCAAATGCTGTTGTTGTTTCTGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1120632636 14:86909711-86909733 CCAGATTCTGTTTTAGATACAGG + Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124713686 15:32036574-32036596 CCAAATGCTGACATGGATAAAGG - Intronic
1126132330 15:45353969-45353991 CCAAATGCTGATATCAATTCAGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1135852174 16:25973724-25973746 ACAAATGCTGCTATTAATTCGGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1143862946 17:9904635-9904657 CGAGATGCTGATATTGATAGAGG - Intronic
1143932181 17:10440580-10440602 GCAAATTCTGTGACTGATACTGG - Intergenic
1149014188 17:51889195-51889217 CCACATTCTGTTACTTATACAGG + Intronic
1152140413 17:78533203-78533225 CCACATGCTGGGATAGATACTGG + Intronic
1153097393 18:1422986-1423008 CCAGATGCTTTTATTTATGCGGG - Intergenic
1154127136 18:11701583-11701605 CATAATGCTGTTATTGATCCTGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156332866 18:36141133-36141155 CCACATGCTAATATTGGTACTGG - Exonic
1156641537 18:39106917-39106939 CCAAAGGCTGATATTGATGGTGG + Intergenic
1158057365 18:53297624-53297646 CCAAAAGCTGTTGCTGTTACGGG - Intronic
1158911244 18:62065049-62065071 CCAAAGGCTGATACTGATGCAGG + Intronic
1159451072 18:68603001-68603023 AAAAAAACTGTTATTGATACAGG - Intergenic
1159864495 18:73688208-73688230 CCAAATTCTGTTATTGAACATGG - Intergenic
1160553153 18:79708306-79708328 ACATTTGCTGTTTTTGATACAGG - Intronic
1161185987 19:2921128-2921150 ACAAATGCTGCATTTGATACTGG + Intergenic
1162492884 19:11004629-11004651 CCATATGCTGTTGTAGATTCAGG - Intronic
1163306438 19:16482581-16482603 CCATATGGTTTTTTTGATACAGG - Exonic
1163656173 19:18546363-18546385 CCAAAGGCTGTTTTTGAGACTGG - Intergenic
1167140168 19:47644807-47644829 CCATATGCTTTTATTTCTACAGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
929323022 2:40568816-40568838 CCAAATGCTGCTTTTGAACCAGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
933385973 2:81610616-81610638 TCAAATGCAGCTATTAATACTGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938413546 2:131085414-131085436 CCAGATGTTGTTATTGATGCTGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941783281 2:169472447-169472469 CCAGATGCTGTGCTAGATACTGG + Intergenic
941951654 2:171161760-171161782 GCAAATGCTGTTATTTATTTTGG - Intronic
943520956 2:188949021-188949043 CTGAATGGTGTTAATGATACCGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169717993 20:8642548-8642570 CCTATTGCTGTCATTGATAATGG - Intronic
1174888741 20:54365995-54366017 GGATATGCAGTTATTGATACAGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177076954 21:16588169-16588191 CCAAATGCAGTTGTGGAAACAGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178892476 21:36531597-36531619 CCAGAGGCTGTTATTGATTGAGG - Intronic
1182017800 22:27055427-27055449 CCAGAAGCTGTTCTTGATACTGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
957322054 3:78643911-78643933 CAAAATGCAGTAATGGATACAGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958650900 3:96935062-96935084 CTAAATGCTCTTAGTGTTACTGG - Intronic
958807262 3:98826669-98826691 CCATATGCTGTTATTGCTACTGG - Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960446091 3:117750650-117750672 CCAAATGCTCTTATTGGCTCTGG + Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
966705699 3:182911343-182911365 CCAGCTGCTGTTAGTGGTACTGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967064602 3:185903664-185903686 CAAAGTGCTGGTATTGTTACAGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971047966 4:22827305-22827327 CCAAATATTGTGATAGATACTGG - Intergenic
972759470 4:42088930-42088952 CCAAATTCTCTTTTTGAGACAGG - Exonic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973818053 4:54636755-54636777 CCAAGCACTGTTATAGATACTGG - Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975147903 4:70990751-70990773 CCAAATTTTATTATTGAGACGGG + Intronic
977359280 4:95982318-95982340 CCAAATGCTGTGAATGCTGCTGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977486469 4:97653670-97653692 CAAAATTATGTTATTGATAATGG + Intronic
977691063 4:99911528-99911550 CCAAATGCTGGTATGGATGCAGG - Intronic
977816770 4:101423635-101423657 CTAAATGCAGTTCATGATACTGG - Intronic
978455151 4:108880703-108880725 CCACATTATGTTATTGATAAGGG + Intronic
980092069 4:128453540-128453562 CCAAATCCTGTTATTGTTACAGG - Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
982334784 4:154222252-154222274 CCAATTTCTGTTATTGCTTCTGG + Intergenic
983715196 4:170773936-170773958 CCAAATGCCATTAGTGATGCTGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
985019612 4:185673841-185673863 ACAAATGCTGTTGATGAGACAGG - Intronic
985041903 4:185899209-185899231 CCAAATGCTGTTATCTAGACCGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986543306 5:8870002-8870024 TAACATACTGTTATTGATACGGG + Intergenic
988633789 5:32959546-32959568 CCAAATTCAGTTAATGAAACTGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990395055 5:55369248-55369270 TCAGATGCTGTCATTGAAACAGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991062765 5:62396246-62396268 CCAAATGCTGGGATTATTACAGG - Intronic
992867923 5:80976407-80976429 CCAAATGCTGTTATTAATTTTGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993392467 5:87337088-87337110 ACAAATACAGTTATAGATACAGG + Intronic
993663769 5:90670193-90670215 CCAAAACCTGTGACTGATACAGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994342016 5:98641379-98641401 CCATATGCTGTTACTAATATTGG - Intergenic
996456669 5:123692505-123692527 CCAAGTGCGGTTATTTATAAAGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000682022 5:164196869-164196891 CCAGATGCTGTTCTAGGTACTGG + Intergenic
1001183553 5:169544535-169544557 CAAAATTCTGTTTTTGAGACAGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1005878652 6:30036383-30036405 CCAAATGCTGTAATCAATATAGG - Intergenic
1006700977 6:35972859-35972881 CCAAATGCACTCATTGATTCTGG - Intronic
1006907425 6:37542287-37542309 CCAAATGCTGTTCTAGGCACTGG + Intergenic
1008318696 6:50079958-50079980 CCACATTCTGTGATTTATACTGG + Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012160791 6:95883109-95883131 TCAAATACTGTTATTAATGCTGG + Intergenic
1012304187 6:97629767-97629789 CCAAATGCTGTGTTTGATTCTGG + Intergenic
1013030119 6:106325094-106325116 CTAAATATTGTTATTGAGACAGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015896903 6:138026320-138026342 CCTAATCTAGTTATTGATACTGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1022575355 7:31492179-31492201 CCATAAGCTGTTACTGAAACTGG + Intergenic
1022761032 7:33351619-33351641 CCAAAGGCTAGTATTGATGCAGG + Intronic
1024976056 7:55114802-55114824 TCAAAAGCTGATATTTATACAGG - Intronic
1027411231 7:77920685-77920707 CAAAATGCTTTTTTTGAGACGGG + Intronic
1028722877 7:94053614-94053636 GAAAGTGCTGTTATTGAAACAGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031944669 7:127826834-127826856 CCAAATTCTGTTAATGACTCTGG - Intronic
1033265552 7:139883434-139883456 CCATATGCTGTTATAGAAAGAGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1039701497 8:39966393-39966415 CCAAAGGCTGAAATTGAAACAGG + Intronic
1041948710 8:63476057-63476079 CCTAATACTGTTATTGAACCTGG + Intergenic
1043087893 8:75858856-75858878 GCAAATGCTTTTATTTCTACAGG - Intergenic
1043215037 8:77574683-77574705 CCGAATGCTGTTCTGGATTCAGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046326034 8:112647921-112647943 CCATATGCTGATACTGCTACAGG - Intronic
1046854902 8:119019783-119019805 CTAGATGCTGTGCTTGATACTGG - Intronic
1047586451 8:126279289-126279311 CGTAATGATGTTACTGATACGGG + Intergenic
1047664374 8:127074655-127074677 CCAGGTGCTGTGATTGACACTGG + Intergenic
1047914145 8:129564103-129564125 CCAGGTGTGGTTATTGATACTGG - Intergenic
1050844819 9:10202428-10202450 CCAAATGCTGTTGTAAGTACAGG + Intronic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059847810 9:118300970-118300992 CCAAATTCTGATACTGATACTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1187937628 X:24351481-24351503 ACGAATGCTGTATTTGATACAGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188838170 X:34984433-34984455 CCAAATGCAGTTAAAGTTACAGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194095944 X:89638590-89638612 AGAAATGCTGTCATTGAAACAGG - Intergenic
1194550497 X:95291870-95291892 CCAAGTGCTGTGATTGAATCAGG + Intergenic
1194756471 X:97744487-97744509 CCAAATGCAGTTATTTGTCCAGG + Intergenic
1195740137 X:108056733-108056755 CCAAATGCTGGTAAGGATGCAGG + Intronic
1197145540 X:123168135-123168157 CCAGATACTGTTCTAGATACTGG - Intergenic
1197500889 X:127241288-127241310 CCACATGCTGTTCTAGATACTGG + Intergenic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1199202561 X:145109763-145109785 GCAAATGCTGTTCTTGGTACAGG - Intergenic
1199370666 X:147043734-147043756 CCTAATGTTGTTAATGATATAGG - Intergenic
1199779436 X:151044719-151044741 CCAAATGGTGTTATGGCTAAAGG - Intergenic
1200448947 Y:3299973-3299995 AGAAATGCTGTCATTGAAACAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201953827 Y:19598506-19598528 TCAAAGTCTGTCATTGATACTGG - Intergenic