ID: 1074078743

View in Genome Browser
Species Human (GRCh38)
Location 10:110151615-110151637
Sequence CCATCCATGTAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074078743_1074078750 -1 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078750 10:110151637-110151659 GAGGCCTCAGAGTGGCCAGAGGG No data
1074078743_1074078754 25 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078754 10:110151663-110151685 TGCTGAGCCTGGCCCTCCCATGG No data
1074078743_1074078755 26 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078755 10:110151664-110151686 GCTGAGCCTGGCCCTCCCATGGG No data
1074078743_1074078756 27 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078756 10:110151665-110151687 CTGAGCCTGGCCCTCCCATGGGG No data
1074078743_1074078749 -2 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078749 10:110151636-110151658 GGAGGCCTCAGAGTGGCCAGAGG No data
1074078743_1074078748 -9 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078748 10:110151629-110151651 CATGGATGGAGGCCTCAGAGTGG No data
1074078743_1074078753 14 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078753 10:110151652-110151674 CCAGAGGGATGTGCTGAGCCTGG No data
1074078743_1074078757 30 Left 1074078743 10:110151615-110151637 CCCTCTTCCTTCTACATGGATGG No data
Right 1074078757 10:110151668-110151690 AGCCTGGCCCTCCCATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074078743 Original CRISPR CCATCCATGTAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr