ID: 1074079715

View in Genome Browser
Species Human (GRCh38)
Location 10:110157859-110157881
Sequence TCATTAGGGCATAAGCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074079715_1074079727 25 Left 1074079715 10:110157859-110157881 CCATGAGGCTTATGCCCTAATGA No data
Right 1074079727 10:110157907-110157929 CCTCCTAATACTATCACATTGGG No data
1074079715_1074079718 -3 Left 1074079715 10:110157859-110157881 CCATGAGGCTTATGCCCTAATGA No data
Right 1074079718 10:110157879-110157901 TGACCCACATCACCTCCCAAAGG No data
1074079715_1074079725 24 Left 1074079715 10:110157859-110157881 CCATGAGGCTTATGCCCTAATGA No data
Right 1074079725 10:110157906-110157928 ACCTCCTAATACTATCACATTGG 0: 36
1: 334
2: 1190
3: 2588
4: 4029
1074079715_1074079728 26 Left 1074079715 10:110157859-110157881 CCATGAGGCTTATGCCCTAATGA No data
Right 1074079728 10:110157908-110157930 CTCCTAATACTATCACATTGGGG 0: 21
1: 211
2: 903
3: 2126
4: 3278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074079715 Original CRISPR TCATTAGGGCATAAGCCTCA TGG (reversed) Intergenic
No off target data available for this crispr