ID: 1074080233

View in Genome Browser
Species Human (GRCh38)
Location 10:110162801-110162823
Sequence CTGTTCAGAAGCGGAAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074080229_1074080233 9 Left 1074080229 10:110162769-110162791 CCTGCAGAATTACTGTGTGAGTT No data
Right 1074080233 10:110162801-110162823 CTGTTCAGAAGCGGAAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074080233 Original CRISPR CTGTTCAGAAGCGGAAGTGT GGG Intergenic
No off target data available for this crispr