ID: 1074086369

View in Genome Browser
Species Human (GRCh38)
Location 10:110210984-110211006
Sequence CCGGGTCCCTGGTTTCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074086362_1074086369 -2 Left 1074086362 10:110210963-110210985 CCGATAGGATTCCAGCATCTACC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1074086369 10:110210984-110211006 CCGGGTCCCTGGTTTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074086369 Original CRISPR CCGGGTCCCTGGTTTCTGGA AGG Intronic
No off target data available for this crispr