ID: 1074092968

View in Genome Browser
Species Human (GRCh38)
Location 10:110280360-110280382
Sequence GAGGGTATACAGTTGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074092962_1074092968 18 Left 1074092962 10:110280319-110280341 CCTCAATTTAGGTTTGTCTGATG 0: 3
1: 51
2: 204
3: 487
4: 855
Right 1074092968 10:110280360-110280382 GAGGGTATACAGTTGGGGTAAGG No data
1074092961_1074092968 19 Left 1074092961 10:110280318-110280340 CCCTCAATTTAGGTTTGTCTGAT 0: 2
1: 55
2: 222
3: 510
4: 974
Right 1074092968 10:110280360-110280382 GAGGGTATACAGTTGGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074092968 Original CRISPR GAGGGTATACAGTTGGGGTA AGG Intronic
No off target data available for this crispr