ID: 1074092968 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:110280360-110280382 |
| Sequence | GAGGGTATACAGTTGGGGTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074092962_1074092968 | 18 | Left | 1074092962 | 10:110280319-110280341 | CCTCAATTTAGGTTTGTCTGATG | 0: 3 1: 51 2: 204 3: 487 4: 855 |
||
| Right | 1074092968 | 10:110280360-110280382 | GAGGGTATACAGTTGGGGTAAGG | No data | ||||
| 1074092961_1074092968 | 19 | Left | 1074092961 | 10:110280318-110280340 | CCCTCAATTTAGGTTTGTCTGAT | 0: 2 1: 55 2: 222 3: 510 4: 974 |
||
| Right | 1074092968 | 10:110280360-110280382 | GAGGGTATACAGTTGGGGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074092968 | Original CRISPR | GAGGGTATACAGTTGGGGTA AGG | Intronic | ||
| No off target data available for this crispr | |||||