ID: 1074095865

View in Genome Browser
Species Human (GRCh38)
Location 10:110311948-110311970
Sequence TTCATGAGCAATAATTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074095865_1074095876 23 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095876 10:110311994-110312016 CTTTGTACATTGGGTTTCATGGG No data
1074095865_1074095878 29 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095878 10:110312000-110312022 ACATTGGGTTTCATGGGGAAAGG No data
1074095865_1074095870 0 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095870 10:110311971-110311993 AGGCTCCTGGTGGTCCTGGTTGG No data
1074095865_1074095872 13 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095872 10:110311984-110312006 TCCTGGTTGGCTTTGTACATTGG No data
1074095865_1074095869 -4 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095869 10:110311967-110311989 TGAAAGGCTCCTGGTGGTCCTGG No data
1074095865_1074095868 -10 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG No data
1074095865_1074095875 22 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095875 10:110311993-110312015 GCTTTGTACATTGGGTTTCATGG No data
1074095865_1074095877 24 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095877 10:110311995-110312017 TTTGTACATTGGGTTTCATGGGG No data
1074095865_1074095874 14 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095874 10:110311985-110312007 CCTGGTTGGCTTTGTACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074095865 Original CRISPR TTCATGAGCAATAATTACAG AGG (reversed) Intergenic
No off target data available for this crispr