ID: 1074095868

View in Genome Browser
Species Human (GRCh38)
Location 10:110311961-110311983
Sequence TGCTCATGAAAGGCTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074095864_1074095868 30 Left 1074095864 10:110311908-110311930 CCTGTAAGAGTTCAAGGGACTTT No data
Right 1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG No data
1074095865_1074095868 -10 Left 1074095865 10:110311948-110311970 CCTCTGTAATTATTGCTCATGAA No data
Right 1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074095868 Original CRISPR TGCTCATGAAAGGCTCCTGG TGG Intergenic
No off target data available for this crispr