ID: 1074105060

View in Genome Browser
Species Human (GRCh38)
Location 10:110383155-110383177
Sequence CTGGAGATGGGGAATGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074105055_1074105060 -2 Left 1074105055 10:110383134-110383156 CCAGTGGATCTAATCAAATGTCT No data
Right 1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074105060 Original CRISPR CTGGAGATGGGGAATGTGTC AGG Intergenic
No off target data available for this crispr