ID: 1074109188

View in Genome Browser
Species Human (GRCh38)
Location 10:110410562-110410584
Sequence GAAAAGGACTTATTTGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074109188_1074109191 -9 Left 1074109188 10:110410562-110410584 CCACCCGCAAATAAGTCCTTTTC No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074109188 Original CRISPR GAAAAGGACTTATTTGCGGG TGG (reversed) Intergenic
No off target data available for this crispr