ID: 1074109191

View in Genome Browser
Species Human (GRCh38)
Location 10:110410576-110410598
Sequence GTCCTTTTCCTTCCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074109183_1074109191 3 Left 1074109183 10:110410550-110410572 CCAGCCACACCCCCACCCGCAAA No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109185_1074109191 -6 Left 1074109185 10:110410559-110410581 CCCCCACCCGCAAATAAGTCCTT No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109184_1074109191 -1 Left 1074109184 10:110410554-110410576 CCACACCCCCACCCGCAAATAAG No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109182_1074109191 10 Left 1074109182 10:110410543-110410565 CCTGGCTCCAGCCACACCCCCAC No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109188_1074109191 -9 Left 1074109188 10:110410562-110410584 CCACCCGCAAATAAGTCCTTTTC No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109187_1074109191 -8 Left 1074109187 10:110410561-110410583 CCCACCCGCAAATAAGTCCTTTT No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109180_1074109191 18 Left 1074109180 10:110410535-110410557 CCCTTTGGCCTGGCTCCAGCCAC No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109181_1074109191 17 Left 1074109181 10:110410536-110410558 CCTTTGGCCTGGCTCCAGCCACA No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data
1074109186_1074109191 -7 Left 1074109186 10:110410560-110410582 CCCCACCCGCAAATAAGTCCTTT No data
Right 1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074109191 Original CRISPR GTCCTTTTCCTTCCTAGAGC AGG Intergenic
No off target data available for this crispr