ID: 1074110258

View in Genome Browser
Species Human (GRCh38)
Location 10:110417729-110417751
Sequence TGCACTGAGGCCCCGTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074110258_1074110267 20 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110267 10:110417772-110417794 GGGCCCAGACTCCAGCTGCAGGG No data
1074110258_1074110271 29 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110271 10:110417781-110417803 CTCCAGCTGCAGGGATGGATTGG No data
1074110258_1074110266 19 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110266 10:110417771-110417793 AGGGCCCAGACTCCAGCTGCAGG No data
1074110258_1074110264 0 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110264 10:110417752-110417774 CAAGGGTCCTTGTTGGAATAGGG No data
1074110258_1074110270 24 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110270 10:110417776-110417798 CCAGACTCCAGCTGCAGGGATGG No data
1074110258_1074110272 30 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110272 10:110417782-110417804 TCCAGCTGCAGGGATGGATTGGG No data
1074110258_1074110263 -1 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110263 10:110417751-110417773 ACAAGGGTCCTTGTTGGAATAGG No data
1074110258_1074110262 -7 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110262 10:110417745-110417767 CAGTGCACAAGGGTCCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074110258 Original CRISPR TGCACTGAGGCCCCGTGAGA TGG (reversed) Intergenic