ID: 1074110261

View in Genome Browser
Species Human (GRCh38)
Location 10:110417742-110417764
Sequence ACAAGGACCCTTGTGCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074110261_1074110275 19 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110275 10:110417784-110417806 CAGCTGCAGGGATGGATTGGGGG No data
1074110261_1074110272 17 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110272 10:110417782-110417804 TCCAGCTGCAGGGATGGATTGGG No data
1074110261_1074110266 6 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110266 10:110417771-110417793 AGGGCCCAGACTCCAGCTGCAGG No data
1074110261_1074110270 11 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110270 10:110417776-110417798 CCAGACTCCAGCTGCAGGGATGG No data
1074110261_1074110276 20 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110276 10:110417785-110417807 AGCTGCAGGGATGGATTGGGGGG No data
1074110261_1074110271 16 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110271 10:110417781-110417803 CTCCAGCTGCAGGGATGGATTGG No data
1074110261_1074110274 18 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110274 10:110417783-110417805 CCAGCTGCAGGGATGGATTGGGG No data
1074110261_1074110267 7 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110267 10:110417772-110417794 GGGCCCAGACTCCAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074110261 Original CRISPR ACAAGGACCCTTGTGCACTG AGG (reversed) Intergenic
No off target data available for this crispr