ID: 1074110265

View in Genome Browser
Species Human (GRCh38)
Location 10:110417759-110417781
Sequence GTCTGGGCCCTATTCCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074110265_1074110267 -10 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110267 10:110417772-110417794 GGGCCCAGACTCCAGCTGCAGGG No data
1074110265_1074110274 1 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110274 10:110417783-110417805 CCAGCTGCAGGGATGGATTGGGG No data
1074110265_1074110278 30 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110278 10:110417812-110417834 TGTTTGGTATCCCCCTGCCCCGG No data
1074110265_1074110270 -6 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110270 10:110417776-110417798 CCAGACTCCAGCTGCAGGGATGG No data
1074110265_1074110271 -1 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110271 10:110417781-110417803 CTCCAGCTGCAGGGATGGATTGG No data
1074110265_1074110272 0 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110272 10:110417782-110417804 TCCAGCTGCAGGGATGGATTGGG No data
1074110265_1074110276 3 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110276 10:110417785-110417807 AGCTGCAGGGATGGATTGGGGGG No data
1074110265_1074110275 2 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110275 10:110417784-110417806 CAGCTGCAGGGATGGATTGGGGG No data
1074110265_1074110277 14 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110277 10:110417796-110417818 TGGATTGGGGGGATTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074110265 Original CRISPR GTCTGGGCCCTATTCCAACA AGG (reversed) Intergenic