ID: 1074110267

View in Genome Browser
Species Human (GRCh38)
Location 10:110417772-110417794
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074110258_1074110267 20 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110267 10:110417772-110417794 GGGCCCAGACTCCAGCTGCAGGG No data
1074110261_1074110267 7 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110267 10:110417772-110417794 GGGCCCAGACTCCAGCTGCAGGG No data
1074110265_1074110267 -10 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110267 10:110417772-110417794 GGGCCCAGACTCCAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074110267 Original CRISPR GGGCCCAGACTCCAGCTGCA GGG Intergenic